Login to display prices
Login to display prices
SH3BP5-SH3-domain binding protein 5 (BTK-associated) Gene View larger

SH3BP5-SH3-domain binding protein 5 (BTK-associated) Gene


New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of SH3BP5-SH3-domain binding protein 5 (BTK-associated) Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about SH3BP5-SH3-domain binding protein 5 (BTK-associated) Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC010123
Product type: DNA & cDNA
Ncbi symbol: SH3BP5
Origin species: Human
Product name: SH3BP5-SH3-domain binding protein 5 (BTK-associated) Gene
Size: 2ug
Accessions: BC010123
Gene id: 9467
Gene description: SH3-domain binding protein 5 (BTK-associated)
Synonyms: SAB; SH3BP-5; SH3 domain-binding protein 5; SH3 domain-binding protein that preferentially associates with BTK; SH3-domain binding protein 5 (BTK-associated); SH3 domain binding protein 5
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggagcaggggctggaggaggaagaagaggtggatccccggatccagggagaactggagaagttaaatcagtccacggatgatatcaacagacgggagactgaacttgaggatgctcgtcagaagttccgctctgttctggttgaagcaacggtgaaactggatgaactggtgaagaaaattggcaaagctgtggaagactccaagccctactgggaggcacggagggtggcgaggcaggctcagctggaagctcagaaagccacgcaggacttccagagggccacagaggtgctccgtgccgccaaggagaccatctccctggccgagcagcggctgctggaggatgacaagcggcagttcgactccgcctggcaggagatgctgaatcacgccactcagagggtcatggaggcggagcagaccaagaccaggagcgagctggtgcataaggagacggcagccaggtacaatgccgccatgggccgcatgcgacagctggagaagaaactcaagagagccatcaacaagtccaagccttattttgaactcaaggcaaagtactatgtgcagctcgagcaactgaaaaagactgtggatgacctgcaggccaaactgaccctggcaaaaggcgagtacaagatggccctgaagaacctggagatgatctcagatgagatccacgagcggcggcgctccagtgccatggggcctcggggatgcggtgttggtgctgagggcagcagcacatctgtggaggatctgccagggagcaaacctgagcctgatgccatttctgtggcctcggaggcctttgaagatgacagctgtagcaactttgtgtctgaagatgactcggaaacccagtccgtgtccagctttagttcaggaccaacaagcccgtctgagatgcctgaccagttccctgcggttgtgaggcctggcagcctggatctgcccagccctgtgtccctgtcagagtttgggatgatgttcccagtgttgggccctcgaagtgaatgcagcggggcctcctcccctgaatgtgaagtagaacgaggagacagggcagaaggggcagagaataaaacaagtgacaaagccaacaacaaccggggcctcagcagtagcagtggcagtggtggcagcagtaagagccaaagcagcacctcccctgagggccaggccttggagaaccggatgaagcagctctccctacagtgctcaaagggaagagatggaattattgctgacataaaaatggtgcagattggctga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - cell division cycle 20 homolog (S. cerevisiae)
- protein disulfide isomerase family A, member 3
- chaperonin containing TCP1, subunit 5 (epsilon)
- acyl-Coenzyme A dehydrogenase family, member 9