CCT5-chaperonin containing TCP1, subunit 5 (epsilon) Gene View larger

CCT5-chaperonin containing TCP1, subunit 5 (epsilon) Gene

PTXBC006543

New product

Data sheet of CCT5-chaperonin containing TCP1, subunit 5 (epsilon) Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about CCT5-chaperonin containing TCP1, subunit 5 (epsilon) Gene

Brand: ProteoGenix
Availability: PRODUCT NOT AVAILABLE
Proteogenix catalog: PTXBC006543
Product type: DNA & cDNA
Ncbi symbol: CCT5
Origin species: Human
Product name: CCT5-chaperonin containing TCP1, subunit 5 (epsilon) Gene
Size: 2ug
Accessions: BC006543
Gene id: 22948
Gene description: chaperonin containing TCP1, subunit 5 (epsilon)
Synonyms: CCT-epsilon; CCTE; HEL-S-69; PNAS-102; TCP-1-epsilon; T-complex protein 1 subunit epsilon; chaperonin containing TCP1, subunit 5 (epsilon); epididymis secretory protein Li 69; chaperonin containing TCP1 subunit 5
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggcgtccatggggaccctcgccttcgatgaatatgggcgccctttcctcatcatcaaggatcaggaccgcaagtcccgtcttatgggacttgaggccctcaagtctcatataatggcagcaaaggctgtagcaaatacaatgagaacatcacttggaccaaatgggcttgataagatgatggtggataaggatggggatgtgactgtaactaatgatggggccaccatcttaagcatgatggatgttgatcatcagattgccaagctgatggtggaactgtccaagtctcaggatgatgaaattggagatggaaccacaggagtggttgtcctggctggtgccttgttagaagaagcggagcaattgctagaccgaggcattcacccaatcagaatagccgatggctatgagcaggctgctcgcgttgctattgaacacctggacaagatcagcgatagcgtccttgttgacataaaggacaccgaacccctgattcagacagcaaaaaccacgctgggctccaaagtggtcaacagttgtcaccgacagatggctgagattgctgtgaatgccgtcctcactgtagcagatatggagcggagagacgttgactttgagcttatcaaagtagaaggcaaagtgggcggcaggctggaggacactaaactgattaagggcgtgattgtggacaaggatttcagtcacccacagatgccaaaaaaagtggaagatgcgaagattgcaattctcacatgtccatttgaaccacccaaaccaaaaacaaagcataagctggatgtgacctctgtcgaagattataaagcccttcagaaatacgaaaaggagaaatttgaagagatgattcaacaaattaaagagactggtgctaacctagcaatttgtcagtggggctttgatgatgaagcaaatcacttacttcttcagaacaacttgcctgcggttcgctgggtaggaggacctgaaattgagctgattgccatcgcaacaggagggcggatcgtccccaggttctcagagctcacagccgagaagctgggctttgctggtcttgtacaggagatctcatttgggacaactaaggataaaatgctggtcatcgagcagtgtaagaactccagagctgtaaccatttttattagaggaggaaataagatgatcattgaggaggcgaaacgatcccttcacgatgctttgtgtgtcatccggaacctcatccgcgataatcgtgtggtgtatggaggaggggctgctgagatatcctgtgccctggcagttagccaagaggcggataagtgccccaccttagaacagtatgccatgagagcgtttgccgacgcactggaggtcatccccatggccctctctgaaaacagtggcatgaatcccatccagactatgaccgaagtccgagccagacaggtgaaggagatgaaccctgctcttggcatcgactgtttgcacaaggggacaaatgatatgaagcaacagcatgtcatagaaaccttgattggcaaaaagcaacagatatctcttgcaacacaaatggttagaatgattttgaagattgatgacattcgtaagcctggagaatctgaagaatga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - acyl-Coenzyme A dehydrogenase family, member 9
- acyl-CoA synthetase long-chain family member 4
- myelin-associated oligodendrocyte basic protein
- transcript expressed during hematopoiesis 2

Buy CCT5-chaperonin containing TCP1, subunit 5 (epsilon) Gene now

Add to cart