Login to display prices
Login to display prices
MGC33894-transcript expressed during hematopoiesis 2 Gene View larger

MGC33894-transcript expressed during hematopoiesis 2 Gene

PTXBC029527

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of MGC33894-transcript expressed during hematopoiesis 2 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about MGC33894-transcript expressed during hematopoiesis 2 Gene

Proteogenix catalog: PTXBC029527
Ncbi symbol: MGC33894
Product name: MGC33894-transcript expressed during hematopoiesis 2 Gene
Size: 2ug
Accessions: BC029527
Gene id: 256302
Gene description: transcript expressed during hematopoiesis 2
Synonyms: C17orf103; Gtlf3b; protein NATD1; N-acetyltransferase domain-containing protein 1; gene trap locus F3b; protein GTLF3B; transcript expressed during hematopoiesis 2; N-acetyltransferase domain containing 1
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggcgcactcggctgccgccgtgccgctgggcgcgctggagcagggctgccccatccgcgtggagcacgaccgccggcgccgccagttcactgtccggctcaacggatgtcatgaccgggccgtcctgctctatgagtacgtgggcaagcggatcgtggacctgcagcacaccgaggtcccagatgcctacagtgggcgtggcatcgccaagcaccttgccaaggccgccctggacttcgtggtggaggaggacctgaaggcccatctcacctgctggtacatccagaagtacgtcaaggagaaccccctgccgcagtacctggagcgcctgcagccgtaa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

30 other products in the same category: