> >>PTPRS-protein tyrosine phosphatase, receptor type, S Gene
PTPRS-protein tyrosine phosphatase, receptor type, S Gene View larger

PTPRS-protein tyrosine phosphatase, receptor type, S Gene

PTXBC029496

New product

113,40 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language
Rate it

Data sheet of PTPRS-protein tyrosine phosphatase, receptor type, S Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about PTPRS-protein tyrosine phosphatase, receptor type, S Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC029496
Product type: DNA & cDNA
Ncbi symbol: PTPRS
Origin species: Human
Product name: PTPRS-protein tyrosine phosphatase, receptor type, S Gene
Size: 2ug
Accessions: BC029496
Gene id: 5802
Gene description: protein tyrosine phosphatase, receptor type, S
Synonyms: PTPSIGMA; R-PTP-S; R-PTP-sigma; receptor-type tyrosine-protein phosphatase S; protein tyrosine phosphatase PTPsigma; receptor-type tyrosine-protein phosphatase sigma; protein tyrosine phosphatase, receptor type S
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggcgcccacctggggccctggcatggtgtctgtggttggtcccatgggcctccttgtggtcctgctcgttggaggctgtgcagcagaagagccccccaggtttatcaaagaacccaaggaccagatcggcgtgtcggggggtgtggcctctttcgtgtgtcaggccacgggtgaccccaagccacgagtgacctggaacaagaagggcaagaaggtcaactctcagcgctttgagacgattgagtttgatgagagtgccggggcagtgctgaggatccagccgctgaggacaccgcgggatgaaaacgtgtacgagtgtgtggcccagaactcggttggggagatcacagtccatgccaagcttactgtcctccgaggaccttga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - spondyloepiphyseal dysplasia, late, pseudogene
- DnaJ (Hsp40) homolog, subfamily C, member 15
- alanine-glyoxylate aminotransferase 2-like 2
- protein tyrosine phosphatase, mitochondrial 1

Reviews

Buy PTPRS-protein tyrosine phosphatase, receptor type, S Gene now

Add to cart