Login to display prices
Login to display prices
AGXT2L2-alanine-glyoxylate aminotransferase 2-like 2 Gene View larger

AGXT2L2-alanine-glyoxylate aminotransferase 2-like 2 Gene


New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of AGXT2L2-alanine-glyoxylate aminotransferase 2-like 2 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about AGXT2L2-alanine-glyoxylate aminotransferase 2-like 2 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC008009
Product type: DNA & cDNA
Ncbi symbol: AGXT2L2
Origin species: Human
Product name: AGXT2L2-alanine-glyoxylate aminotransferase 2-like 2 Gene
Size: 2ug
Accessions: BC008009
Gene id: 85007
Gene description: alanine-glyoxylate aminotransferase 2-like 2
Synonyms: AGXT2L2; PHLU; 5-phosphohydroxy-L-lysine phospho-lyase; 5-phosphonooxy-L-lysine phospho-lyase; alanine--glyoxylate aminotransferase 2-like 2
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgggcaagtccattggcaacggccaccctgttgcctgcgtggccgcaacccagcctgtggcgagggcatttgaagccaccggcgttgagtacttcaacacgtttgggggcagcccagtgtcctgcgctgtggggctggccgtcctgaatgtcttggagaaggagcagctccaggatcatgccaccagtgtaggcagcttcctgatgcagctcctcgggcagcaaaaaatcaaacatcccatcgtcggggatgtcaggggtgttgggctcttcattggtgtggatctgatcaaagatgaggccacaaggacaccagcaactgaagaggctgcctacttggtatcaaggctgaaggagaactacgttttgctgagcactgatggccctgggaggaacatcctgaagtttaagcccccaatgtgcttcagcctggacaatgcacggcaggtggtggcaaagctggatgccattctgactgacatggaagagaaggtgagaagttgtgaaacgctgaggctccagccctaa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - protein tyrosine phosphatase, mitochondrial 1
- ubiquitin specific peptidase 6 (Tre-2 oncogene)
- SH3 domain binding glutamic acid-rich protein
- complement component 1, q subcomponent, B chain