Login to display prices
Login to display prices
AGXT2L2-alanine-glyoxylate aminotransferase 2-like 2 Gene View larger

AGXT2L2-alanine-glyoxylate aminotransferase 2-like 2 Gene

PTXBC008009

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of AGXT2L2-alanine-glyoxylate aminotransferase 2-like 2 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about AGXT2L2-alanine-glyoxylate aminotransferase 2-like 2 Gene

Proteogenix catalog: PTXBC008009
Ncbi symbol: AGXT2L2
Product name: AGXT2L2-alanine-glyoxylate aminotransferase 2-like 2 Gene
Size: 2ug
Accessions: BC008009
Gene id: 85007
Gene description: alanine-glyoxylate aminotransferase 2-like 2
Synonyms: AGXT2L2; PHLU; 5-phosphohydroxy-L-lysine phospho-lyase; 5-phosphonooxy-L-lysine phospho-lyase; alanine--glyoxylate aminotransferase 2-like 2
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgggcaagtccattggcaacggccaccctgttgcctgcgtggccgcaacccagcctgtggcgagggcatttgaagccaccggcgttgagtacttcaacacgtttgggggcagcccagtgtcctgcgctgtggggctggccgtcctgaatgtcttggagaaggagcagctccaggatcatgccaccagtgtaggcagcttcctgatgcagctcctcgggcagcaaaaaatcaaacatcccatcgtcggggatgtcaggggtgttgggctcttcattggtgtggatctgatcaaagatgaggccacaaggacaccagcaactgaagaggctgcctacttggtatcaaggctgaaggagaactacgttttgctgagcactgatggccctgggaggaacatcctgaagtttaagcccccaatgtgcttcagcctggacaatgcacggcaggtggtggcaaagctggatgccattctgactgacatggaagagaaggtgagaagttgtgaaacgctgaggctccagccctaa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice