PTPMT1-protein tyrosine phosphatase, mitochondrial 1 Gene View larger

PTPMT1-protein tyrosine phosphatase, mitochondrial 1 Gene

PTXBC020242

New product

113,40 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of PTPMT1-protein tyrosine phosphatase, mitochondrial 1 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about PTPMT1-protein tyrosine phosphatase, mitochondrial 1 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC020242
Product type: DNA & cDNA
Ncbi symbol: PTPMT1
Origin species: Human
Product name: PTPMT1-protein tyrosine phosphatase, mitochondrial 1 Gene
Size: 2ug
Accessions: BC020242
Gene id: 114971
Gene description: protein tyrosine phosphatase, mitochondrial 1
Synonyms: DUSP23; MOSP; PLIP; PNAS-129; phosphatidylglycerophosphatase and protein-tyrosine phosphatase 1; NB4 apoptosis/differentiation related protein; PTEN-like phosphatase; phosphoinositide lipid phosphatase; protein tyrosine phosphatase, mitochondrial 1
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggcggccaccgcgctgctggaggccggcctggcgcgggtgctcttctacccgacgctgctctacaccctgttccgcgggaaggtgccgggtcgggcgcaccgggactggtaccaccgcatcgaccccaccgtgctgctgggcgcgctgccgttgcggagcttgacgcgccagctggtacaggacgagaacgtgcgcggggtgatcaccatgaacgaggagtacgagacgaggttcctgtgcaactcttcacaggagtggaagagactaggagtcgagcagctgcggctcagcacagtagacatgactgggatccccaccttggacaacctccagaagggagtccaatttgctctcaagtaccagtcgctgggccagtgtgtttacgtgcattgtaaggctgggcgctccaggagtgccactatggtggcagcatacctgattcaggtgcacaaatggagtccagaggaggctgtaagagccatcgccaagatccggtcatacatccacatcaggcctggccagctggatgttcttaaagagttccacaagcagattactgcacgggcaacaaaggatgggacttttgtcatttcaaagacatga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - ubiquitin specific peptidase 6 (Tre-2 oncogene)
- SH3 domain binding glutamic acid-rich protein
- complement component 1, q subcomponent, B chain
- Spi-B transcription factor (Spi-1/PU.1 related)

Buy PTPMT1-protein tyrosine phosphatase, mitochondrial 1 Gene now

Add to cart