Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
Data sheet of USP6-ubiquitin specific peptidase 6 (Tre-2 oncogene) Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about USP6-ubiquitin specific peptidase 6 (Tre-2 oncogene) Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC029495 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | USP6 |
| Origin species: | Human |
| Product name: | USP6-ubiquitin specific peptidase 6 (Tre-2 oncogene) Gene |
| Size: | 2ug |
| Accessions: | BC029495 |
| Gene id: | 9098 |
| Gene description: | ubiquitin specific peptidase 6 (Tre-2 oncogene) |
| Synonyms: | ubiquitin-specific protease USP6; USP6-short; HRP1; TRE17; TRE2; TRESMCR; Tre-2; ubiquitin carboxyl-terminal hydrolase 6; TBC1D3 and USP32 fusion; deubiquitinating enzyme 6; hyperpolymorphic gene 1; proto-oncogene TRE-2; ubiquitin specific peptidase 6 (Tre-2 oncogene); ubiquitin specific protease 6 (Tre-2 oncogene); ubiquitin thioesterase 6; ubiquitin thiolesterase 6; ubiquitin-specific-processing protease 6; ubiquitin specific peptidase 6 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggtagagaatgcagatagtttgcaggcacaggagcggaaggacatacttatgaagtatgacaagggacaccgagctgggctgccagaggacaaggggcctgagcccgttggaatcaacagcagcattgatcgttttggcattttgcagtcctgcccctcctgggagtcagagccacaggaaggcccttgtcctcccttccctgtgccttctcccgggctgagccctgagctggatagggacagagccagtcctttctgggggtcggctcccaggcttgggcggctccaggccctgtgcacgtcctcagctctgcctgggttgccttacagtgagacggagctgcctcctgtgactgcacgggaggcgaagaaaattcggcgggagatgacacgaacgagcaagtggatggaaatgctgggagaatgggagacatataagcacagtagcaaactcatagatcgagtgtacaagggaattcccatgaacatccggggcccggtgtggtcagtcctcctgaacattcaggaaatcaagttgaaaaaccccggaagataccagatcatgaaggagaggggcaagaggtcatctgaacacatccaccacatcgacctggacgtgaggacgactctccggaaccatgtcttctttagggatcgatatggagccaagtaa |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - SH3 domain binding glutamic acid-rich protein - complement component 1, q subcomponent, B chain - Spi-B transcription factor (Spi-1/PU.1 related) - matrix metallopeptidase 7 (matrilysin, uterine) |