Login to display prices
Login to display prices
USP6-ubiquitin specific peptidase 6 (Tre-2 oncogene) Gene View larger

USP6-ubiquitin specific peptidase 6 (Tre-2 oncogene) Gene

PTXBC029495

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of USP6-ubiquitin specific peptidase 6 (Tre-2 oncogene) Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about USP6-ubiquitin specific peptidase 6 (Tre-2 oncogene) Gene

Proteogenix catalog: PTXBC029495
Ncbi symbol: USP6
Product name: USP6-ubiquitin specific peptidase 6 (Tre-2 oncogene) Gene
Size: 2ug
Accessions: BC029495
Gene id: 9098
Gene description: ubiquitin specific peptidase 6 (Tre-2 oncogene)
Synonyms: ubiquitin-specific protease USP6; USP6-short; HRP1; TRE17; TRE2; TRESMCR; Tre-2; ubiquitin carboxyl-terminal hydrolase 6; TBC1D3 and USP32 fusion; deubiquitinating enzyme 6; hyperpolymorphic gene 1; proto-oncogene TRE-2; ubiquitin specific peptidase 6 (Tre-2 oncogene); ubiquitin specific protease 6 (Tre-2 oncogene); ubiquitin thioesterase 6; ubiquitin thiolesterase 6; ubiquitin-specific-processing protease 6; ubiquitin specific peptidase 6
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggtagagaatgcagatagtttgcaggcacaggagcggaaggacatacttatgaagtatgacaagggacaccgagctgggctgccagaggacaaggggcctgagcccgttggaatcaacagcagcattgatcgttttggcattttgcagtcctgcccctcctgggagtcagagccacaggaaggcccttgtcctcccttccctgtgccttctcccgggctgagccctgagctggatagggacagagccagtcctttctgggggtcggctcccaggcttgggcggctccaggccctgtgcacgtcctcagctctgcctgggttgccttacagtgagacggagctgcctcctgtgactgcacgggaggcgaagaaaattcggcgggagatgacacgaacgagcaagtggatggaaatgctgggagaatgggagacatataagcacagtagcaaactcatagatcgagtgtacaagggaattcccatgaacatccggggcccggtgtggtcagtcctcctgaacattcaggaaatcaagttgaaaaaccccggaagataccagatcatgaaggagaggggcaagaggtcatctgaacacatccaccacatcgacctggacgtgaggacgactctccggaaccatgtcttctttagggatcgatatggagccaagtaa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

30 other products in the same category: