Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
Data sheet of MMP7-matrix metallopeptidase 7 (matrilysin, uterine) Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about MMP7-matrix metallopeptidase 7 (matrilysin, uterine) Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC003635 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | MMP7 |
| Origin species: | Human |
| Product name: | MMP7-matrix metallopeptidase 7 (matrilysin, uterine) Gene |
| Size: | 2ug |
| Accessions: | BC003635 |
| Gene id: | 4316 |
| Gene description: | matrix metallopeptidase 7 (matrilysin, uterine) |
| Synonyms: | MPSL1; PUMP-1; matrilysin; matrin; matrix metallopeptidase 7 (matrilysin, uterine); matrix metalloproteinase 7 (matrilysin, uterine); matrix metalloproteinase-7; pump-1 protease; uterine matrilysin; uterine metalloproteinase; matrix metallopeptidase 7 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgcgactcaccgtgctgtgtgctgtgtgcctgctgcctggcagcctggccctgccgctgcctcaggaggcgggaggcatgagtgagctacagtgggaacaggctcaggactatctcaagagattttatctctatgactcagaaacaaaaaatgccaacagtttagaagccaaactcaaggagatgcaaaaattctttggcctacctataactggaatgttaaactcccacgtcatagaaataatgcagaagcccagatgtggagtgccagatgttgcagaatactcactatttccaaatagcccaaaatggacttccaaagtggtcacctacaggatcgtatcatatactcgagacttaccgcatattacagtggatcgattagtgtcaaaggctttaaacatgtggggcaaagagatccccctgcatttcaggaaagttgtatggggaactgctgacatcatgattggctttgcgcgaggagctcatggggactcctacccatttgatgggccaggaaacacgctggctcatgcctttgcgcctgggacaggtctcggaggagatgctcacttcgatgaggatgaacgctggacggatggtagcagtctagggattaacttcctgtatgctgcaactcatgaacttggccattctttgggtatgggacattcctctgatcctaatgcagtgatgtatccaacctatggaaatggagatccccaaaattttaaactttcccaggatgatattaaaggcattcagaaactatatggaaagagaagtaattcaagaaagaaatag |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - DnaJ (Hsp40) homolog, subfamily C, member 27 - S phase cyclin A-associated protein in the ER - nicotinamide nucleotide adenylyltransferase 2 - NIMA (never in mitosis gene a)-related kinase 6 |