Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
Data sheet of NEK6-NIMA (never in mitosis gene a)-related kinase 6 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about NEK6-NIMA (never in mitosis gene a)-related kinase 6 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC000101 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | NEK6 |
| Origin species: | Human |
| Product name: | NEK6-NIMA (never in mitosis gene a)-related kinase 6 Gene |
| Size: | 2ug |
| Accessions: | BC000101 |
| Gene id: | 10783 |
| Gene description: | NIMA (never in mitosis gene a)-related kinase 6 |
| Synonyms: | serine/threonine-protein kinase Nek6; SID6-1512; NIMA (never in mitosis gene a)-related kinase 6; never in mitosis A-related kinase 6; nimA-related protein kinase 6; protein kinase SID6-1512; NIMA related kinase 6 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggcaggacagcccggccacatgccccatggagggagttccaacaacctctgccacaccctggggcctgtgcatcctcctgacccacagaggcatcccaacacgctgtcttttcgctgctcgctggcggacttccagatcgaaaagaagataggccgaggacagttcagcgaggtgtacaaggccacctgcctgctggacaggaagacagtggctctgaagaaggtgcagatctttgagatgatggacgccaaggcgaggcaggactgtgtcaaggagatcggcctcttgaagcaactgaaccacccaaatatcatcaagtatttggactcgtttatcgaagacaacgagctgaacattgtgctggagttggctgacgcaggggacctctcgcagatgatcaagtactttaagaagcagaagcggctcatcccggagaggacagtatggaagtactttgtgcagctgtgcagcgccgtggagcacatgcattcacgccgggtgatgcaccgagacatcaagcctgccaacgtgttcatcacagccacgggcgtcgtgaagctcggtgaccttggtctgggccgcttcttcagctctgagaccaccgcagcccactccctagtggggacgccctactacatgtcaccggagaggatccatgagaacggctacaacttcaagtccgacatctggtccttgggctgtctgctgtacgagatggcagccctccagagccccttctatggagataagatgaatctcttctccctgtgccagaagatcgagcagtgtgactaccccccactccccggggagcactactccgagaagttacgagaactggtcagcatgtgcatctgccctgacccccaccagagacctgacatcggatacgtgcaccaggtggccaagcagatgcacatctggatgtccagcacctga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - tumor-associated calcium signal transducer 1 - tumor-associated calcium signal transducer 2 - interferon (alpha, beta and omega) receptor 2 - MOCO sulphurase C-terminal domain containing 2 |