Login to display prices
Login to display prices
NEK6-NIMA (never in mitosis gene a)-related kinase 6 Gene View larger

NEK6-NIMA (never in mitosis gene a)-related kinase 6 Gene

PTXBC000101

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of NEK6-NIMA (never in mitosis gene a)-related kinase 6 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about NEK6-NIMA (never in mitosis gene a)-related kinase 6 Gene

Proteogenix catalog: PTXBC000101
Ncbi symbol: NEK6
Product name: NEK6-NIMA (never in mitosis gene a)-related kinase 6 Gene
Size: 2ug
Accessions: BC000101
Gene id: 10783
Gene description: NIMA (never in mitosis gene a)-related kinase 6
Synonyms: serine/threonine-protein kinase Nek6; SID6-1512; NIMA (never in mitosis gene a)-related kinase 6; never in mitosis A-related kinase 6; nimA-related protein kinase 6; protein kinase SID6-1512; NIMA related kinase 6
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggcaggacagcccggccacatgccccatggagggagttccaacaacctctgccacaccctggggcctgtgcatcctcctgacccacagaggcatcccaacacgctgtcttttcgctgctcgctggcggacttccagatcgaaaagaagataggccgaggacagttcagcgaggtgtacaaggccacctgcctgctggacaggaagacagtggctctgaagaaggtgcagatctttgagatgatggacgccaaggcgaggcaggactgtgtcaaggagatcggcctcttgaagcaactgaaccacccaaatatcatcaagtatttggactcgtttatcgaagacaacgagctgaacattgtgctggagttggctgacgcaggggacctctcgcagatgatcaagtactttaagaagcagaagcggctcatcccggagaggacagtatggaagtactttgtgcagctgtgcagcgccgtggagcacatgcattcacgccgggtgatgcaccgagacatcaagcctgccaacgtgttcatcacagccacgggcgtcgtgaagctcggtgaccttggtctgggccgcttcttcagctctgagaccaccgcagcccactccctagtggggacgccctactacatgtcaccggagaggatccatgagaacggctacaacttcaagtccgacatctggtccttgggctgtctgctgtacgagatggcagccctccagagccccttctatggagataagatgaatctcttctccctgtgccagaagatcgagcagtgtgactaccccccactccccggggagcactactccgagaagttacgagaactggtcagcatgtgcatctgccctgacccccaccagagacctgacatcggatacgtgcaccaggtggccaagcagatgcacatctggatgtccagcacctga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

30 other products in the same category: