TACSTD1-tumor-associated calcium signal transducer 1 Gene View larger

TACSTD1-tumor-associated calcium signal transducer 1 Gene


New product

121,50 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of TACSTD1-tumor-associated calcium signal transducer 1 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about TACSTD1-tumor-associated calcium signal transducer 1 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC014785
Product type: DNA & cDNA
Ncbi symbol: TACSTD1
Origin species: Human
Product name: TACSTD1-tumor-associated calcium signal transducer 1 Gene
Size: 2ug
Accessions: BC014785
Gene id: 4072
Gene description: tumor-associated calcium signal transducer 1
Synonyms: TACSTD1; DIAR5; EGP-2; EGP314; EGP40; ESA; HNPCC8; KS1/4; KSA; M4S1; MIC18; MK-1; TROP1; epithelial cell adhesion molecule; adenocarcinoma-associated antigen; cell surface glycoprotein Trop-1; epithelial glycoprotein 314; human epithelial glycoprotein-2; major gastrointestinal tumor-associated protein GA733-2; membrane component, chromosome 4, surface marker (35kD glycoprotein); tumor-associated calcium signal transducer 1
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggcgcccccgcaggtcctcgcgttcgggcttctgcttgccgcggcgacggcgacttttgccgcagctcaggaagaatgtgtctgtgaaaactacaagctggccgtaaactgctttgtgaataataatcgtcaatgccagtgtacttcagttggtgcacaaaatactgtcatttgctcaaagctggctgccaaatgtttggtgatgaaggcagaaatgaatggctcaaaacttgggagaagagcaaaacctgaaggggccctccagaacaatgatgggctttatgatcctgactgcgatgagagcgggctctttaaggccaagcagtgcaacggcacctccacgtgctggtgtgtgaacactgctggggtcagaagaacagacaaggacactgaaataacctgctctgagcgagtgagaacctactggatcatcattgaactaaaacacaaagcaagagaaaaaccttatgatagtaaaagtttgcggactgcacttcagaaggagatcacaacgcgttatcaactggatccaaaatttatcacgagtattttgtatgagaataatgttatcactattgatctggttcaaaattcttctcaaaaaactcagaatgatgtggacatagctgatgtggcttattattttgaaaaagatgttaaaggtgaatccttgtttcattctaagaaaatggacctgacagtaaatggggaacaactggatctggatcctggtcaaactttaatttattatgttgatgaaaaagcacctgaattctcaatgcagggtctaaaagctggtgttattgctgttattgtggttgtggtgatagcagttgttgctggaattgttgtgctggttatttccagaaagaagagaatggcaaagtatgagaaggctgagataaaggagatgggtgagatgcatagggaactcaatgcataa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - tumor-associated calcium signal transducer 2
- interferon (alpha, beta and omega) receptor 2
- MOCO sulphurase C-terminal domain containing 2
- capping protein (actin filament), gelsolin-like

Buy TACSTD1-tumor-associated calcium signal transducer 1 Gene now

Add to cart