MOSC2-MOCO sulphurase C-terminal domain containing 2 Gene View larger

MOSC2-MOCO sulphurase C-terminal domain containing 2 Gene


New product

121,50 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of MOSC2-MOCO sulphurase C-terminal domain containing 2 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about MOSC2-MOCO sulphurase C-terminal domain containing 2 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC016859
Product type: DNA & cDNA
Ncbi symbol: MOSC2
Origin species: Human
Product name: MOSC2-MOCO sulphurase C-terminal domain containing 2 Gene
Size: 2ug
Accessions: BC016859
Gene id: 54996
Gene description: MOCO sulphurase C-terminal domain containing 2
Synonyms: MOSC2; mitochondrial amidoxime reducing component 2; MOCO sulphurase C-terminal domain containing 2; MOSC domain-containing protein 2, mitochondrial; moco sulfurase C-terminal domain-containing protein 2; molybdenum cofactor sulfurase C-terminal domain-containing protein 2
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgggcgcttccagctcctccgcgctggcccgcctcggcctcccagcccggccctggcccaggtggctcggcgtcgccgcgctaggactggccgccgtggccctggggactgtcgcctggcgccgcgcatggcccaggcggcgccggcggctgcagcaggtgggcaccgtggcgaagctctggatctacccggtgaaatcctgcaaaggggtgccggtgagcgaggctgagtgcacggccatggggctgcgcagcggcaacctgcgggacaggttttggctggtgattaaggaagatggacacatggtcactgcccgacaggagcctcgcctcgtgctcatctccatcatttatgagaataactgcctgatcttcagggctccagacatggaccagctggttttgcctagcaagcagccttcctcaaacaaactccacaactgcaggatatttggccttgacattaaaggcagagactgtggcaatgaggcagctaagtggttcaccaacttcttgaaaactgaagcatatagattggttcaatttgagacaaacatgaagggaagaacatcaagaaaacttctccccactcttgatcagaatttccaggtggcctacccagactactgcccgctcctgatcatgacagatgcctccctggtagatttgaataccaggatggagaagaaaatgaaaatggagaatttcaggccaaatattgtggtgaccggctgtgatgcttttgaggaggatacctgggatgaactcctaattggtagtgtagaagtgaaaaaggtaatggcatgccccaggtgtattttgacaacggtggacccagacactggagtcatagacaggaaacagccactggacaccctgaagagctaccgcctgtgtgatccttctgagagggaattgtacaagttgtctccactttttgggatctattattcagtggaaaaaattggaagcctgagagttggtgaccctgtgtatcggatggtgtag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - capping protein (actin filament), gelsolin-like
- serologically defined colon cancer antigen 3
- serologically defined colon cancer antigen 8
- dihydrouridine synthase 1-like (S. cerevisiae)

Buy MOSC2-MOCO sulphurase C-terminal domain containing 2 Gene now

Add to cart