DUS1L-dihydrouridine synthase 1-like (S. cerevisiae) Gene View larger

DUS1L-dihydrouridine synthase 1-like (S. cerevisiae) Gene


New product

121,50 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of DUS1L-dihydrouridine synthase 1-like (S. cerevisiae) Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about DUS1L-dihydrouridine synthase 1-like (S. cerevisiae) Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC017081
Product type: DNA & cDNA
Ncbi symbol: DUS1L
Origin species: Human
Product name: DUS1L-dihydrouridine synthase 1-like (S. cerevisiae) Gene
Size: 2ug
Accessions: BC017081
Gene id: 64118
Gene description: dihydrouridine synthase 1-like (S. cerevisiae)
Synonyms: DUS1; PP3111; tRNA-dihydrouridine(16/17) synthase [NAD(P)(+)]-like; dihydrouridine synthase 1 like
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgatagccaagagaggtcactatggcgcctttctgcaggacgagtgggacctgctccaaagaatgattttgctggcccacgagaaactctctgttcctgtcacgtgcaaaatccgtgtcttcccggagattgacaagaccgtgaggtacgcccagatgctggagaaggccggctgccagttgctgacggtgcacggacgcaccaaggagcagaaggggcccctgtcgggtgcagcgtcctgggagcatatcaaggctgtgcggaaggctgtggccatccctgtgtttgctaacgggaacatccagtgcctgcaggacgtggagcgctgcctccgggacacgggtgtgcagggcgtcatgagcgcagagggcaacctgcacaaccccgccctgttcgagggccggagccctgccgtgtgggagctggccgaggagtatctggacatcgtgcgggagcacccctgccccctgtcctacgtccgggcccacctcttcaagctgtggcaccacacgctgcaggtgcaccaggagctgcgagaggagctggccaaggtgaagaccctggagggcatcgctgctgtgagccaggagctgaagctgcggtgtcaggaggagatatccaggcaggagggagcgaagcccaccggcgacttgcccttccactggatctgccagccctacatccggccggggcccagggaggggagcaaggagaaggcaggtgcgcgcagcaagcgggccctggaggaagaggagggtggcacggaggtcctgtccaagaacaagcaaaagaagcagctgaggaacccccacaagaccttcgacccctctctgaagccaaaatatgcaaagtgtgaccagtgtggaaacccaaagggcaacagatgtgtgttcagcctgtgccgcggctgctgcaagaagcgagcctccaaagagactgcagactgcccaggtcacggattgctttttaaaaccaaattggagaagtctctggcctggaaagaggcccagcctgagctgcaggagcctcagccagcagcacctggaacaccaggtggcttctccgaagtcatgggcagtgccctggcctga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - developmentally regulated GTP binding protein 1
- mitochondrial transcription termination factor
- WW domain containing transcription regulator 1
- dihydrouridine synthase 3-like (S. cerevisiae)

Buy DUS1L-dihydrouridine synthase 1-like (S. cerevisiae) Gene now

Add to cart