MTERF-mitochondrial transcription termination factor Gene View larger

MTERF-mitochondrial transcription termination factor Gene


New product

121,50 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of MTERF-mitochondrial transcription termination factor Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about MTERF-mitochondrial transcription termination factor Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC000965
Product type: DNA & cDNA
Ncbi symbol: MTERF
Origin species: Human
Product name: MTERF-mitochondrial transcription termination factor Gene
Size: 2ug
Accessions: BC000965
Gene id: 7978
Gene description: mitochondrial transcription termination factor
Synonyms: MTERF; transcription termination factor 1, mitochondrial; transcription termination factor, mitochondrial; mitochondrial transcription termination factor 1
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgcagagcctttccttaggacaaacaagcatttcaaaaggtttgaactacctaaccattatggcaccaggaaacctctggcatatgagaaataactttctctttggttcaagatgttggatgactcgattttcagcagaaaacatcttcaaatcagtttcatttaggctttttggtgtgaagtgtcataatacagacagtgagcctttgaaaaatgaggacctactgaaaaacttacttactatgggagtagatattgatatggcaaggaaacgacagcctggagtttttcataggatgattaccaatgagcaggacctgaagatgttccttctttccaaaggagctagcaaagaagtgatcgctagcatcatatcaagatatccacgagcaataacacgtactcccgagaatctttcaaaacggtgggatctgtggagaaagattgtgacatcagaccttgaaattgtaaatattttggaacgttctcctgaatccttttttcggtccaataacaacctaaacttagagaataatataaagttcctctactcagttggattgacccgtaaatgcctttgtcgattgttgaccaatgcccctcgtaccttctccaatagtcttgatctgaataaacagatggttgaatttttgcaggcagccggtttgtcattgggtcacaatgatcccacagattttgtcagaaagataatttttaaaaacccttttatcttaattcagagcaccaagcgggtgaaagctaacattgaattcttacggtcaactttcaatttgaacagtgaggaactgctggttctgatatgtggtccaggagctgaaatcctagacctttccaatgactatgccagaagaagctacgcaaacatcaaagagaagctgttttctcttggatgtactgaagaagaggtacagaagtttgtcttaagctatccagatgtgatcttcttggcagagaaaaagtttaatgataaaatagactgcctcatggaagaaaacattagcatttcacaaataatcgaaaatcctcgggttctggattcaagcataagtactttaaaaagtcgaatcaaagaattggtaaatgctggctgtaacttgagtactttaaacatcactcttctatcttggagtaaaaaaagatatgaagctaaattgaaaaagttaagcagatttgcctaa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - WW domain containing transcription regulator 1
- dihydrouridine synthase 3-like (S. cerevisiae)
- protein disulfide isomerase family A, member 6
- alanine-glyoxylate aminotransferase 2-like 2

Buy MTERF-mitochondrial transcription termination factor Gene now

Add to cart