PDIA6-protein disulfide isomerase family A, member 6 Gene View larger

PDIA6-protein disulfide isomerase family A, member 6 Gene


New product

121,50 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of PDIA6-protein disulfide isomerase family A, member 6 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about PDIA6-protein disulfide isomerase family A, member 6 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC001312
Product type: DNA & cDNA
Ncbi symbol: PDIA6
Origin species: Human
Product name: PDIA6-protein disulfide isomerase family A, member 6 Gene
Size: 2ug
Accessions: BC001312
Gene id: 10130
Gene description: protein disulfide isomerase family A, member 6
Synonyms: ERP5; TXNDC7; protein disulfide-isomerase A6; ER protein 5; endoplasmic reticulum protein 5; protein disulfide isomerase P5; protein disulfide isomerase-associated 6; protein disulfide isomerase-related protein; thioredoxin domain containing 7 (protein disulfide isomerase); thioredoxin domain-containing protein 7; protein disulfide isomerase family A member 6
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggctctcctggtgctcggtctggtgagctgtaccttctttctggcagtgaatggtctgtattcctctagtgatgatgtgatcgaattaactccatcgaatttcaaccgagaagttattcagagtgatagtttgtggcttgtagaattctatgctccatggtgtggtcactgtcaaagattaacaccagaatggaagaaagcagcaactgcattaaaagatgttgtcaaagttggtgcagttgatgcagataagcatcattccctaggaggtcagtatggtgttcagggatttcctaccattaagatttttggatccaacaaaaacagaccagaagattaccaaggtggcagaactggtgaagccattgtagatgctgcgctgagtgctctgcgccagctcgtgaaggatcgcctcgggggacggagcggaggatacagttctggaaaacaaggcagaagtgatagttcaagtaagaaggatgtgattgagctgacagacgacagctttgataagaatgttctggacagtgaagatgtttggatggttgagttctatgctccttggtgtggacactgcaaaaacctagagccagagtgggctgccgcagcttcagaagtaaaagagcagacgaaaggaaaagtgaaactggcagctgtggatgctacagtcaatcaggttctggcctcccgatacgggattagaggatttcctacaatcaagatatttcagaaaggcgagtctcctgtggattatgacggtgggcggacaagatccgacatcgtgtcccgggcccttgatttgttttctgataacgccccacctcctgagctgcttgagattatcaacgaggacattgccaagaggacgtgtgaggagcaccagctctgtgttgtggctgtgctgccccatatccttgatactggagctgcaggcagaaattcttatctggaagttcttctgaagttggcagacaaatacaaaaagaaaatgtgggggtggctgtggacagaagctggagcccagtctgaacttgagaccgcgttggggattggagggtttgggtaccccgccatggccgccatcaatgcacgcaagatgaaatttgctctgctaaaaggctccttcagtgagcaaggcatcaacgagtttctcagggagctctcttttgggcgtggctccacggcacctgtaggaggcggggctttccctaccatcgttgagagagagccttgggacggcagggatggcgagcttcccgtggaggatgacattgacctcagtgatgtggagcttgatgacttagggaaagatgagttgtga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - alanine-glyoxylate aminotransferase 2-like 2
- calcium/calmodulin-dependent protein kinase IV
- HSPB (heat shock 27kDa) associated protein 1
- erythrocyte membrane protein band 4.1 like 5

Buy PDIA6-protein disulfide isomerase family A, member 6 Gene now

Add to cart