Login to display prices
Login to display prices
HSPBAP1-HSPB (heat shock 27kDa) associated protein 1 Gene View larger

HSPBAP1-HSPB (heat shock 27kDa) associated protein 1 Gene

PTXBC011897

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of HSPBAP1-HSPB (heat shock 27kDa) associated protein 1 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about HSPBAP1-HSPB (heat shock 27kDa) associated protein 1 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC011897
Product type: DNA & cDNA
Ncbi symbol: HSPBAP1
Origin species: Human
Product name: HSPBAP1-HSPB (heat shock 27kDa) associated protein 1 Gene
Size: 2ug
Accessions: BC011897
Gene id: 79663
Gene description: HSPB (heat shock 27kDa) associated protein 1
Synonyms: PASS1; HSPB1-associated protein 1; 27 kDa heat shock protein-associated protein 1; HSPB (heat shock 27kDa) associated protein 1; protein associating with small stress protein PASS1; HSPB1 associated protein 1
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggcagcaggctccgaggcgaccactcctgtgatcgttgcggctggggctggaggggaggaaggtgaacatgtcaaaccttttaagccagagaaagcaaaagaaattatcatgtctttacaacaacctgcaatcttctgtaacatggtgtttgattggccagcacgacactggaatgctaaatacctttcgcaggtccttcatggcaagcagatacgattcagaatggggatgaaaagcatgagcacagttcctcagtttgaaactacatgtaattacgtagaagctacactcgaagagtttctgacctggaactgtgaccagtctagtatttctggaccatttagagattatgaccattccaagttctgggcttatgctgactataaatattttgtcagtctatttgaagacaagacagatcttttccaggatgtgaaatggtctgacttcgggtttcctggaagaaatggacaggaaagtacattgtggattggctccttgggagcccacacaccctgtcatctggactcctatggttgtaacttggtattccaggtacaaggaaggaaacgatggcatctctttcctcctgaagatactcctttcctttatccaactagaatcccttatgaagaatctagtgtgttcagtaaaatcaatgttgtcaatcctgatttaaagcgttttcctcagttccggaaagctcaaagacatgcggttacactgagcccaggacaggttctctttgttcccagacactggtggcattacgtagaatccattgatcctgtcactgtcagtataaactcatggattgaactggaagaggatcacctagcccgggtagaagaggcaatcacccgtatgcttgtgtgtgccctgaaaactgcagagaatccacaaaataccagagcctggttaaaccccactgaggttgaggaaacgtcccatgcagtcaactgttgctacttaaatgcagctgtttctgcattttttgatcgctgcagaacatctgaggtagtagaaatccaagcactgagaacagatggagagcacatgaaaaaggaagaattaaatgtgtgcaaccacatggaggtgggccaaacaggtagccagaacttgaccacaggaacagacaaaccggaggcagcaagtccctttggccctgatctggtccctgtagcacagaggtccgaagaaccgccttcagaaagaggaggcatatttggaagtgatgggaaagactttgtggacaaggatggagaacactttggaaaattgcattgtgccaagagacaacaaataatgagcaacagtgaaaatgcaattgaggaacagattgcctcaaatactactacgactcctcaaacattcatttctacggatgacttgctggactgcttggtgaatccacaagtaaccaggatagtggcacaacttttgatacaaggaagaagtttatga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - erythrocyte membrane protein band 4.1 like 5
- NIMA (never in mitosis gene a)-related kinase 3
- DnaJ (Hsp40) homolog, subfamily C, member 11
- macrophage receptor with collagenous structure