Login to display prices
Login to display prices
CAMK4-calcium/calmodulin-dependent protein kinase IV Gene View larger

CAMK4-calcium/calmodulin-dependent protein kinase IV Gene

PTXBC016695

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of CAMK4-calcium/calmodulin-dependent protein kinase IV Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about CAMK4-calcium/calmodulin-dependent protein kinase IV Gene

Proteogenix catalog: PTXBC016695
Ncbi symbol: CAMK4
Product name: CAMK4-calcium/calmodulin-dependent protein kinase IV Gene
Size: 2ug
Accessions: BC016695
Gene id: 814
Gene description: calcium/calmodulin-dependent protein kinase IV
Synonyms: CaMK IV; CaMK-GR; caMK; calcium/calmodulin-dependent protein kinase type IV; CAM kinase IV; CAM kinase- GR; brain Ca(2+)-calmodulin-dependent protein kinase type IV; brain Ca++-calmodulin-dependent protein kinase type IV; calcium/calmodulin-dependent protein kinase type IV catalytic chain; calcium/calmodulin dependent protein kinase IV
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgctcaaagtcacggtgccctcctgctccgcctcgtcctgctcttcggtcaccgccagtgcggccccggggaccgcgagcctcgtcccggattactggatcgacggctccaacagggatgcgctgagcgatttcttcgaggtggagtcggagctgggacggggtgctacatccattgtgtacagatgcaaacagaaggggacccagaagccttatgctctcaaagtgttaaagaaaacagtggacaaaaaaatcgtaagaactgagataggagttcttcttcgcctctcacatccaaacattataaaacttaaagagatatttgaaacccctacagaaatcagtctggtcctagaactcgtcacaggaggagaactgtttgataggattgtggaaaagggatattacagtgagcgagatgctgcagatgccgttaaacaaatcctggaggcagttgcttatctacatgaaaatgggattgtccatcgtgatctcaaaccagagaatcttctttatgcaactccagccccagatgcaccactcaaaatcgctgattttggactctctaaaattgtggaacatcaagtgctcatgaagacagtatgtggaaccccagggtactgcgcacctgaaattcttagaggttgtgcctatggacctgaggtggacatgtggtctgtaggaataatcacctacatcttactttgtggatttgaaccattctatgatgaaagaggcgatcagttcatgttcaggagaattctgaattgtgaatattactttatctccccctggtgggatgaagtatctctaaatgccaaggacttggtcagaaaattaattgttttggatccaaagaaacggctgactacatttcaagctctccagcatccgtgggtcacaggtaaagcagccaattttgtacacatggataccgctcaaaagaagctccaagaattcaatgcccggcgtaagcttaaggcagcggtgaaggctgtggtggcctcttcccgcctgggaagtgccagcagcagccatggcagcatccaggagagccacaaggctagccgagacccttctccaatccaagatggcaacgaggacatgaaagctattccagaaggagagaaaattcaaggcgatggggcccaagccgcagttaagggggcacaggctgagctgatgaaggtgcaagccttagagaaagttaaaggtgcagatataaatgctgaagaggcccccaaaatggtgcccaaggcagtggaggatgggataaaggtggctgacctggaactagaggagggcctagcagaggagaagctgaagactgtggaggaggcagcagctcccagagaagggcaaggaagctctgctgtgggttttgaagttccacagcaagatgtgatcctgccagagtactaa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

30 other products in the same category: