Cart 6 Product Products 966,30 € (empty)
-
1 x CCRK-cell...121,50 € -
1 x MTERF-mito...121,50 € -
1 x IL4-interl...113,40 € -
1 x MMS19-MMS1...121,50 € -
-
1 x C7orf36-ch...113,40 €
No products
To be determined Shipping
966,30 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 6 items in your cart. There is 1 item in your cart.
Total products (tax excl.) 966,30 €
Total shipping (tax excl.) To be determined
Total (tax excl.) 966,30 €
View larger 
Data sheet of AGXT2L2-alanine-glyoxylate aminotransferase 2-like 2 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about AGXT2L2-alanine-glyoxylate aminotransferase 2-like 2 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC037567 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | AGXT2L2 |
| Origin species: | Human |
| Product name: | AGXT2L2-alanine-glyoxylate aminotransferase 2-like 2 Gene |
| Size: | 2ug |
| Accessions: | BC037567 |
| Gene id: | 85007 |
| Gene description: | alanine-glyoxylate aminotransferase 2-like 2 |
| Synonyms: | AGXT2L2; PHLU; 5-phosphohydroxy-L-lysine phospho-lyase; 5-phosphonooxy-L-lysine phospho-lyase; alanine--glyoxylate aminotransferase 2-like 2 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggccgcagaccagcgcccgaaggccgacacgctggccctgaggcaacggctcatcagctcttcctgcagactcttttttcccgaggatcctgttaagattgtccgggcccaagggcagtacatgtacgatgaacagggggcagaatacatcgattgcatcagcaatgtggcgcacgttgggcactgccaccctctcgtggtccaagcagcacatgagcagaaccaggtgctcaacaccaacagccggtacctgcatgacaacatcgtggactatgcgcagaggctgtcagagaccctgccggagcagctctgtgtgttctatttcctgaattctgggtcagaagccaatgacctggccctgaggctggctcgccactacacgggacaccaggacgtggtggtattagatcatgcgtatcacggccacctgagctccctgattgacatcagtccctacaagttccgcaacctggatggccagaaggagtgggtccacgtggcacctctcccagacacctaccggggcccctaccgggaggaccaccccaacccagctatggcctatgccaacgaggtgaaacgtgtggtcagcagtgcacaggagaagggcaggaagattgcagccttcttcgctgagtctctgcccagtgtgggagggcagatcattccccctgctggctacttctcccaagtggcagagcacatccgcaaggccggaggggtctttgttgcagatgagatccaggttggctttggccgggtaggcaagcacttctgggccttccagctccagggaaaagacttcgtccctgacatcgtcaccatgggcaagtccattggcaacggccaccctgttgcctgcgtggccgcaacccagcctgtggcgagggcatttgaagccaccggcgttgagtacttcaacacgtttgggggcagcccagtgtcctgcgctgtggggctggccgtcctgaatgtcttggagaaggagcagctccaggatcatgccaccagtgtaggcagcttcctgatgcagctcctcgggcagcaaaaaatcaaacatcccatcgtcggggatgtcaggggtgttgggctcttcattggtgtggatctgatcaaagatgaggccacaaggacaccagcaactgaagaggctgcctacttggtatcaaggctgaaggagaactacgttttgctgagcactgatggccctgggaggaacatcctgaagtttaagcccccaatgtgcttcagcctggacaatgcacggcaggtggtggcaaagctggatgccattctgactgacatggaagagaaggtgagaagttgtgaaacgctgaggctccagccctaa |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - calcium/calmodulin-dependent protein kinase IV - HSPB (heat shock 27kDa) associated protein 1 - erythrocyte membrane protein band 4.1 like 5 - NIMA (never in mitosis gene a)-related kinase 3 |