Login to display prices
Login to display prices
DUS3L-dihydrouridine synthase 3-like (S. cerevisiae) Gene View larger

DUS3L-dihydrouridine synthase 3-like (S. cerevisiae) Gene


New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of DUS3L-dihydrouridine synthase 3-like (S. cerevisiae) Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about DUS3L-dihydrouridine synthase 3-like (S. cerevisiae) Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC004549
Product type: DNA & cDNA
Ncbi symbol: DUS3L
Origin species: Human
Product name: DUS3L-dihydrouridine synthase 3-like (S. cerevisiae) Gene
Size: 2ug
Accessions: BC004549
Gene id: 56931
Gene description: dihydrouridine synthase 3-like (S. cerevisiae)
Synonyms: DUS3; tRNA-dihydrouridine(47) synthase [NAD(P)(+)]-like; dihydrouridine synthase 3 like
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggcggagggaacggcggaggctcctctagagaatggtggtggtggcgactcgggagccggagctttggaacgaggagtggcgcccattaagcgtcaatacctcaccaccaaggagcagtttcaccaattcctggaagccaaagggcaggagaagacttgccgggaaaccgagctggacatccgtggcaaactttacctggcccccctcaccacgtgtgggaacctgcccttccgacggatctgcaagcgcttcggggcggatgtgacatgtggagagatggccgtctgcaccaacctgctgcagggccagatgtccgagtgggccctactcaaacgccaccagtgtgaggacatctttggcgtccagctggagggcgccttccccgacaccatgaccaagtgtgccgagctgctgagccgcaccgtggaggtggactttgtggacatcaacgtcggctgccccatcgacctcgtgtacaagaagggtgggggctgtgccctcatgaatcgctccaccaagttccagcagatcgtccgtggcatgaaccaggtgctggatgtgccgctgactgtgaagatccgcacaggcgtccaggagcgtgtgaacctggcgcaccgcctgctgcccgagctgcgggactggggcgtggcactcgtcacgctccacggccgctctcgggagcagcgctacaccaagctagccgactggcagtacatcgaggagtgcgtgcaggccgccagccccatgcccctgttcggaaatggggacatcttgtcatttgaggatgccaaccgcgccatgcagactggtgtcaccgggatcatgattgcccgtggcgccctgctcaagccgtggctcttcacggagatcaaggagcagcggcactgggacatctcgtcgtccgagcgcctggacatcctgcgggacttcaccaactacggcctggagcactggggctcggacacgcagggcgtggagaagacccggcgctttctgctcgagtggctgtccttcctgtgccggtacgtgcccgtggggctgctggagcggctcccacagaggatcaacgagcggccgccctactacctgggccgcgactacctggagacgctgatggccagccagaaggcagccgactggatccgcatcagcgagatgctccttgggccagtgccccccagcttcgccttcttgccgaagcacaaggccaacgcgtacaagtag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - protein disulfide isomerase family A, member 6
- alanine-glyoxylate aminotransferase 2-like 2
- calcium/calmodulin-dependent protein kinase IV
- HSPB (heat shock 27kDa) associated protein 1