WWTR1-WW domain containing transcription regulator 1 Gene View larger

WWTR1-WW domain containing transcription regulator 1 Gene

PTXBC014052

New product

121,50 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of WWTR1-WW domain containing transcription regulator 1 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about WWTR1-WW domain containing transcription regulator 1 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC014052
Product type: DNA & cDNA
Ncbi symbol: WWTR1
Origin species: Human
Product name: WWTR1-WW domain containing transcription regulator 1 Gene
Size: 2ug
Accessions: BC014052
Gene id: 25937
Gene description: WW domain containing transcription regulator 1
Synonyms: TAZ; WW domain-containing transcription regulator protein 1; transcriptional co-activator with PDZ-binding motif; transcriptional coactivator with PDZ-binding motif; WW domain containing transcription regulator 1
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgaatccggcctcggcgccccctccgctcccgccgcctgggcagcaagtgatccacgtcacgcaggacctagacacagacctcgaagccctcttcaactctgtcatgaatccgaagcctagctcgtggcggaagaagatcctgccggagtctttctttaaggagcctgattcgggctcgcactcgcgccagtccagcaccgactcgtcgggcggccacccggggcctcgactggctgggggtgcccagcatgtccgctcgcactcgtcgcccgcgtccctgcagctgggcaccggcgcgggtgctgcgggtagccccgcgcagcagcacgcgcacctccgccagcagtcctacgacgtgaccgacgagctgccactgcccccgggctgggagatgaccttcacggccactggccagaggtacttcctcaatcacatagaaaaaatcaccacatggcaagaccctaggaaggcgatgaatcagcctctgaatcatatgaacctccaccctgccgtcagttccacaccagtgcctcagaggtccatggcagtatcccagccaaatctcgtgatgaatcaccaacaccagcagcagatggcccccagtaccctgagccagcagaaccaccccactcagaacccacccgcagggctcatgagtatgcccaatgcgctgaccactcagcagcagcagcagcagaaactgcggcttcagagaatccagatggagagagaaaggattcgaatgcgccaagaggagctcatgaggcaggaagctgccctctgtcgacagctccccatggaagctgagactcttgccccagttcaggctgctgtcaacccacccacgatgaccccagacatgagatccatcactaataatagctcagatcctttcctcaatggagggccatatcattcgagggagcagagcactgacagtggcctggggttagggtgctacagtgtccccacaactccggaggacttcctcagcaatgtggatgagatggatacaggagaaaacgcaggacaaacacccatgaacatcaatccccaacagacccgtttccctgatttccttgactgtcttccaggaacaaacgttgacttaggaactttggaatctgaagacctgatccccctcttcaatgatgtagagtctgctctgaacaaaagtgagccctttctaacctggctgtaa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - dihydrouridine synthase 3-like (S. cerevisiae)
- protein disulfide isomerase family A, member 6
- alanine-glyoxylate aminotransferase 2-like 2
- calcium/calmodulin-dependent protein kinase IV

Buy WWTR1-WW domain containing transcription regulator 1 Gene now

Add to cart