DRG1-developmentally regulated GTP binding protein 1 Gene View larger

DRG1-developmentally regulated GTP binding protein 1 Gene


New product

121,50 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of DRG1-developmentally regulated GTP binding protein 1 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about DRG1-developmentally regulated GTP binding protein 1 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC019285
Product type: DNA & cDNA
Ncbi symbol: DRG1
Origin species: Human
Product name: DRG1-developmentally regulated GTP binding protein 1 Gene
Size: 2ug
Accessions: BC019285
Gene id: 4733
Gene description: developmentally regulated GTP binding protein 1
Synonyms: NEDD3; developmentally-regulated GTP-binding protein 1; DRG-1; NEDD-3; neural precursor cell expressed developmentally down-regulated protein 3; neural precursor cell expressed, developmentally down-regulated 3; developmentally regulated GTP binding protein 1
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgagcagcaccttagctaagatcgcggagatagaagcagagatggctcggactcaaaagaacaaggccacagcacaccacttagggctgcttaaggctcgtcttgctaagcttcgtcgagaactcattactccaaagggtggtggtggtggaggtccaggagaaggttttgatgtggccaagacaggtgatgctcgaattggatttgttggttttccatctgtggggaagtcaacactgcttagtaacctggcaggggtatattctgaggtggcagcctatgaattcactactctgaccactgtgcctggtgtcatcagatacaaaggtgccaagatccagctcctggatctcccaggtatcattgaaggtgccaaggatgggaaaggtagaggtcgtcaagtcattgcagtggcccgaacctgtaacttgatcttgattgttctggatgtcctgaaacctttgggacataagaagataattgaaaatgagctggaaggctttggcattcgcttgaacagcaaaccccccaacattggctttaagaagaaggacaagggaggcattaatctcacagccacttgcccccagagtgagctggatgctgaaactgtgaagagcattctggctgaatacaagattcataatgccgatgtgactctacgtagtgatgctacagctgatgacctcattgatgtggtggaaggaaacagagtttatatcccctgtatctatgtgttaaataagattgaccaaatctccattgaggaattggatatcatctataaggtgcctcactgtgtacccatctctgcccatcaccgctggaattttgatgacctattggaaaagatctgggactatctgaaactagtgagaatttacaccaaacccaaaggccagttaccagattacacatccccagtggtgcttccttactccaggaccacagtggaggatttctgcatgaagattcacaaaaatcttatcaaagaatttaaatatgctctggtctggggtctctctgtgaaacacaatcctcagaaagtgggtaaagaccatacgttggaggatgaggatgtcattcaaattgtgaagaagtga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - mitochondrial transcription termination factor
- WW domain containing transcription regulator 1
- dihydrouridine synthase 3-like (S. cerevisiae)
- protein disulfide isomerase family A, member 6

Buy DRG1-developmentally regulated GTP binding protein 1 Gene now

Add to cart