Product successfully added to your shopping cart
Quantity
Total
There are 3 items in your cart. There is 1 item in your cart.
Total products (tax excl.) 812,60 €
Total shipping (tax excl.) To be determined
Total (tax excl.) 812,60 €
View larger 
Data sheet of DRG1-developmentally regulated GTP binding protein 1 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about DRG1-developmentally regulated GTP binding protein 1 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC019285 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | DRG1 |
| Origin species: | Human |
| Product name: | DRG1-developmentally regulated GTP binding protein 1 Gene |
| Size: | 2ug |
| Accessions: | BC019285 |
| Gene id: | 4733 |
| Gene description: | developmentally regulated GTP binding protein 1 |
| Synonyms: | NEDD3; developmentally-regulated GTP-binding protein 1; DRG-1; NEDD-3; neural precursor cell expressed developmentally down-regulated protein 3; neural precursor cell expressed, developmentally down-regulated 3; developmentally regulated GTP binding protein 1 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgagcagcaccttagctaagatcgcggagatagaagcagagatggctcggactcaaaagaacaaggccacagcacaccacttagggctgcttaaggctcgtcttgctaagcttcgtcgagaactcattactccaaagggtggtggtggtggaggtccaggagaaggttttgatgtggccaagacaggtgatgctcgaattggatttgttggttttccatctgtggggaagtcaacactgcttagtaacctggcaggggtatattctgaggtggcagcctatgaattcactactctgaccactgtgcctggtgtcatcagatacaaaggtgccaagatccagctcctggatctcccaggtatcattgaaggtgccaaggatgggaaaggtagaggtcgtcaagtcattgcagtggcccgaacctgtaacttgatcttgattgttctggatgtcctgaaacctttgggacataagaagataattgaaaatgagctggaaggctttggcattcgcttgaacagcaaaccccccaacattggctttaagaagaaggacaagggaggcattaatctcacagccacttgcccccagagtgagctggatgctgaaactgtgaagagcattctggctgaatacaagattcataatgccgatgtgactctacgtagtgatgctacagctgatgacctcattgatgtggtggaaggaaacagagtttatatcccctgtatctatgtgttaaataagattgaccaaatctccattgaggaattggatatcatctataaggtgcctcactgtgtacccatctctgcccatcaccgctggaattttgatgacctattggaaaagatctgggactatctgaaactagtgagaatttacaccaaacccaaaggccagttaccagattacacatccccagtggtgcttccttactccaggaccacagtggaggatttctgcatgaagattcacaaaaatcttatcaaagaatttaaatatgctctggtctggggtctctctgtgaaacacaatcctcagaaagtgggtaaagaccatacgttggaggatgaggatgtcattcaaattgtgaagaagtga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - mitochondrial transcription termination factor - WW domain containing transcription regulator 1 - dihydrouridine synthase 3-like (S. cerevisiae) - protein disulfide isomerase family A, member 6 |