Login to display prices
Login to display prices
SDCCAG3-serologically defined colon cancer antigen 3 Gene View larger

SDCCAG3-serologically defined colon cancer antigen 3 Gene


New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of SDCCAG3-serologically defined colon cancer antigen 3 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about SDCCAG3-serologically defined colon cancer antigen 3 Gene

Proteogenix catalog: PTXBC014515
Ncbi symbol: SDCCAG3
Product name: SDCCAG3-serologically defined colon cancer antigen 3 Gene
Size: 2ug
Accessions: BC014515
Gene id: 10807
Gene description: serologically defined colon cancer antigen 3
Synonyms: NY-CO-3; serologically defined colon cancer antigen 3; antigen NY-CO-3
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgtgctatgtgcccagcccggtgctggcttccgtgggagacacagatgacagatttgaagatctggaagaggcaaatccattctcttttagagagtttctgaagaccaagaacctcggcctctcgaaagaggatccggccagcagaatttatgcaaaggaagcctcgaggcattccctgggacttgaccacaactccccaccctcccaaaccggcgggtatggcctggagtatcagcagccatttttcgaggatccgacaggggctggtgacctcctggatggggaggaggatgaggacaccggatggagtggggcctacctgccgtccgccatcgagcagactcaccccgagagggtccctgccggcacgtcgccctgcagcacatacctttcctttttctccaccccgtcggagctggcagggcctgagtctctgccctcgtgggcgttgagtgacactgattctcgcgtgtctccggcctctccggcagggagtcctagcgcagactttgcggttcatggagagtctctgggagacaggcacctgcggacgctgcagataagttacgacgcactgaaagatgaaaattctaagctgagaagaaagctgaatgaggttcagagcttctctgaagctcaaacagaaatggtgaggacgcttgagcggaagttagaagcaaaaatgatcaaggaggaaagcgactaccacgacctggagtcggtggttcagcaggtggagcagaacctggagctgatgaccaaacgggctgtaaaggcagaaaaccacgtcgtgaaactaaaacaggaaatcagtttgctccaggcgcaggtctccaacttccagcgagagaatgaagccctgcggtgcggccagggcgccagcctgaccgtggtgaagcagaacgccgacgtggccctgcagaacctccgggtggtcatgaacagtgcacaggcttccatcaagcaactggtttccggagctgagacactgaatcttgttgccgaaatccttaaatctatagacagaatttctgaaattaaagacgaggaggaagactcttga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

30 other products in the same category: