SDCCAG8-serologically defined colon cancer antigen 8 Gene View larger

SDCCAG8-serologically defined colon cancer antigen 8 Gene


New product

121,50 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of SDCCAG8-serologically defined colon cancer antigen 8 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about SDCCAG8-serologically defined colon cancer antigen 8 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC032454
Product type: DNA & cDNA
Ncbi symbol: SDCCAG8
Origin species: Human
Product name: SDCCAG8-serologically defined colon cancer antigen 8 Gene
Size: 2ug
Accessions: BC032454
Gene id: 10806
Gene description: serologically defined colon cancer antigen 8
Synonyms: BBS16; CCCAP; CCCAP SLSN7; HSPC085; NPHP10; NY-CO-8; SLSN7; hCCCAP; serologically defined colon cancer antigen 8; Bardet-Biedl syndrome 16; Senior-Loken syndrome 7; antigen NY-CO-8; centrosomal colon cancer autoantigen protein; nephrocystin 10
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggcgaagtccccggagaactctaccctggaggagattctggggcagtatcaacggagtctccgggaacatgccagcagaagcattcaccaactgacatgtgccctgaaagaaggcgatgtcactattggagaagatgcaccaaatctttcttttagcaccagtgtgggaaatgaggacgccaggacagcctggcccgaattacaacagagccatgctgttaatcagctcaaagatttgttgcgccaacaagcagataaggaaagtgaagtatctccgtcaagaagaagaaaaatgtcccccttgaggtcattagaacatgaggaaaccaatatgcctactatgcacgaccttgttcatactattaatgaccagtctcaatatattcatcatttagaggcagaagttaagttctgcaaggaggaactctctggaatgaaaaataaaatacaagtagttgtgcttgaaaacgaagggctccagcaacagctaaaatctcaaagacaagaggagacactgagggaacaaacacttctggatgcatccggaaacatgcacaattcttggattacaacaggtgaagattctggggtgggcgaaacctccaaaagaccattttcccatgacaatgcagattttggcaaagctgcatctgctggtgagcagctagaactggagaagctaaaacttacttatgaggaaaagtgtgaaattgaggaatcccaattgaagtttttgaggaacgacttagctgaatatcagagaacttgtgaagatcttaaagagcaactaaagcataaagaatttcttctggctgctaatacttgtaaccgtgttggtggtctttgtttgaaatgtgctcagcatgaagctgttctttcccaaacccatactaatgttcatatgcagaccatcgaaagactggttaaagaaagagatgacttgatgtctgcactagtttccgtaaggagcagcttggcagatacgcagcaaagagaagcaagtgcttatgaacaggtgaaacaagttttgcaaatatctgaggaagccaattttgaaaaaaccaagcacccttcacaatag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - dihydrouridine synthase 1-like (S. cerevisiae)
- developmentally regulated GTP binding protein 1
- mitochondrial transcription termination factor
- WW domain containing transcription regulator 1

Buy SDCCAG8-serologically defined colon cancer antigen 8 Gene now

Add to cart