Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
Data sheet of IFNAR2-interferon (alpha, beta and omega) receptor 2 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about IFNAR2-interferon (alpha, beta and omega) receptor 2 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC002793 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | IFNAR2 |
| Origin species: | Human |
| Product name: | IFNAR2-interferon (alpha, beta and omega) receptor 2 Gene |
| Size: | 2ug |
| Accessions: | BC002793 |
| Gene id: | 3455 |
| Gene description: | interferon (alpha, beta and omega) receptor 2 |
| Synonyms: | IFN-R; IFN-alpha-REC; IFNABR; IFNARB; IMD45; interferon alpha/beta receptor 2; IFN-R-2; IFN-alpha/beta receptor 2; human interferon alpha/beta receptor; interferon (alpha, beta and omega) receptor 2; interferon alpha binding protein; interferon receptor; interferon-alpha/beta receptor beta chain; type I interferon receptor 2; interferon alpha and beta receptor subunit 2 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgcttttgagccagaatgccttcatcgtcagatcacttaatttggttctcatggtgtatatcagcctcgtgtttggtatttcatatgattcgcctgattacacagatgaatcttgcactttcaagatatcattgcgaaatttccggtccatcttatcatgggaattaaaaaaccactccattgtaccaactcactatacattgctgtatacaatcatgagtaaaccagaagatttgaaggtggttaagaactgtgcaaataccacaagatcattttgtgacctcacagatgagtggagaagcacacacgaggcctatgtcaccgtcctagaaggattcagcgggaacacaacgttgttcagttgctcacacaatttctggctggccatagacatgtcttttgaaccaccagagtttgagattgttggttttaccaaccacattaatgtgatggtgaaatttccatctattgttgaggaagaattacagtttgatttatctctcgtcattgaagaacagtcagagggaattgttaagaagcataaacccgaaataaaaggaaacatgagtggaaatttcacctatatcattgacaagttaattccaaacacgaactactgtgtatctgtttatttagagcacagtgatgagcaagcagtaataaagtctcccttaaaatgcaccctccttccacctggccaggaatcagaatcagcagaatctgccaaaataggaggaataattactgtgtttttgatagcattggtcttgacaagcaccatagtgacactgaaatggattggttatatatgcttaagaaatagcctccccaaagtcttgaggcaaggtctcactaagggctggaatgcagtggctattcacaggtgcagtcataatgcactacagtctgaaactcctgagctcaaacagtcgtcctgcctaagcttccccagtagctgggattacaagcgtgcatccctgtgccccagtgattaa |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - MOCO sulphurase C-terminal domain containing 2 - capping protein (actin filament), gelsolin-like - serologically defined colon cancer antigen 3 - serologically defined colon cancer antigen 8 |