IFNAR2-interferon (alpha, beta and omega) receptor 2 Gene View larger

IFNAR2-interferon (alpha, beta and omega) receptor 2 Gene

PTXBC002793

New product

121,50 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of IFNAR2-interferon (alpha, beta and omega) receptor 2 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about IFNAR2-interferon (alpha, beta and omega) receptor 2 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC002793
Product type: DNA & cDNA
Ncbi symbol: IFNAR2
Origin species: Human
Product name: IFNAR2-interferon (alpha, beta and omega) receptor 2 Gene
Size: 2ug
Accessions: BC002793
Gene id: 3455
Gene description: interferon (alpha, beta and omega) receptor 2
Synonyms: IFN-R; IFN-alpha-REC; IFNABR; IFNARB; IMD45; interferon alpha/beta receptor 2; IFN-R-2; IFN-alpha/beta receptor 2; human interferon alpha/beta receptor; interferon (alpha, beta and omega) receptor 2; interferon alpha binding protein; interferon receptor; interferon-alpha/beta receptor beta chain; type I interferon receptor 2; interferon alpha and beta receptor subunit 2
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgcttttgagccagaatgccttcatcgtcagatcacttaatttggttctcatggtgtatatcagcctcgtgtttggtatttcatatgattcgcctgattacacagatgaatcttgcactttcaagatatcattgcgaaatttccggtccatcttatcatgggaattaaaaaaccactccattgtaccaactcactatacattgctgtatacaatcatgagtaaaccagaagatttgaaggtggttaagaactgtgcaaataccacaagatcattttgtgacctcacagatgagtggagaagcacacacgaggcctatgtcaccgtcctagaaggattcagcgggaacacaacgttgttcagttgctcacacaatttctggctggccatagacatgtcttttgaaccaccagagtttgagattgttggttttaccaaccacattaatgtgatggtgaaatttccatctattgttgaggaagaattacagtttgatttatctctcgtcattgaagaacagtcagagggaattgttaagaagcataaacccgaaataaaaggaaacatgagtggaaatttcacctatatcattgacaagttaattccaaacacgaactactgtgtatctgtttatttagagcacagtgatgagcaagcagtaataaagtctcccttaaaatgcaccctccttccacctggccaggaatcagaatcagcagaatctgccaaaataggaggaataattactgtgtttttgatagcattggtcttgacaagcaccatagtgacactgaaatggattggttatatatgcttaagaaatagcctccccaaagtcttgaggcaaggtctcactaagggctggaatgcagtggctattcacaggtgcagtcataatgcactacagtctgaaactcctgagctcaaacagtcgtcctgcctaagcttccccagtagctgggattacaagcgtgcatccctgtgccccagtgattaa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - MOCO sulphurase C-terminal domain containing 2
- capping protein (actin filament), gelsolin-like
- serologically defined colon cancer antigen 3
- serologically defined colon cancer antigen 8

Buy IFNAR2-interferon (alpha, beta and omega) receptor 2 Gene now

Add to cart