Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
Data sheet of TACSTD2-tumor-associated calcium signal transducer 2 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about TACSTD2-tumor-associated calcium signal transducer 2 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC009409 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | TACSTD2 |
| Origin species: | Human |
| Product name: | TACSTD2-tumor-associated calcium signal transducer 2 Gene |
| Size: | 2ug |
| Accessions: | BC009409 |
| Gene id: | 4070 |
| Gene description: | tumor-associated calcium signal transducer 2 |
| Synonyms: | truncated TACSTD2; EGP-1; EGP1; GA733-1; GA7331; GP50; M1S1; TROP2; tumor-associated calcium signal transducer 2; 40kD glycoprotein, identified by monoclonal antibody GA733; cell surface glycoprotein TROP2; cell surface glycoprotein Trop-2; epithelial glycoprotein-1; gastrointestinal tumor-associated antigen GA7331; membrane component, chromosome 1, surface marker 1; pancreatic carcinoma marker protein GA733-1; pancreatic carcinoma marker protein GA7331 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggctcggggccccggcctcgcgccgccaccgctgcggctgccgctgctgctgctggtgctggcggcggtgaccggccacacggccgcgcaggacaactgcacgtgtcccaccaacaagatgaccgtgtgcagccccgacggccccggcggccgctgccagtgccgcgcgctgggctcgggcatggcggtcgactgctccacgctgacctccaagtgtctgctgctcaaggcgcgcatgagcgcccccaagaacgcccgcacgctggtgcggccgagtgagcacgcgctcgtggacaacgatggcctctacgaccccgactgcgaccccgagggccgcttcaaggcgcgccagtgcaaccagacgtcggtgtgctggtgcgtgaactcggtgggcgtgcgccgcacggacaagggcgacctgagcctacgctgcgatgagctggtgcgcacccaccacatcctcattgacctgcgccaccgccccaccgccggcgccttcaaccactcagacctggacgccgagctgaggcggctcttccgcgagcgctatcggctgcaccccaagttcgtggcggccgtgcactacgagcagcccaccatccagatcgagctgcggcagaacacgtctcagaaggccgccggtgacgtggatatcggcgatgccgcctactacttcgagagggacatcaagggcgagtctctattccagggccgcggcggcctggacttgcgcgtgcgcggagaacccctgcaggtggagcgcacgctcatctattacctggacgagattcccccgaagttctccatgaagcgcctcaccgccggcctcatcgctgtcatcgtggtggtcgtggtggccctcgtcgccggcatggccgtcctggtgatcaccaaccggagaaagtcggggaagtacaagaaggtggagatcaaggaactgggggagttgagaaaggaaccgagcttgtag |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - interferon (alpha, beta and omega) receptor 2 - MOCO sulphurase C-terminal domain containing 2 - capping protein (actin filament), gelsolin-like - serologically defined colon cancer antigen 3 |