Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
Data sheet of DNAJC27-DnaJ (Hsp40) homolog, subfamily C, member 27 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about DNAJC27-DnaJ (Hsp40) homolog, subfamily C, member 27 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC034049 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | DNAJC27 |
| Origin species: | Human |
| Product name: | DNAJC27-DnaJ (Hsp40) homolog, subfamily C, member 27 Gene |
| Size: | 2ug |
| Accessions: | BC034049 |
| Gene id: | 51277 |
| Gene description: | DnaJ (Hsp40) homolog, subfamily C, member 27 |
| Synonyms: | RBJ; RabJS; dnaJ homolog subfamily C member 27; DnaJ (Hsp40) homolog, subfamily C, member 27; Ras-associated protein Rap1; rab and DnaJ domain-containing protein; DnaJ heat shock protein family (Hsp40) member C27 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggaggccaacatgccgaagcggaaggagcctggcaggtctctccgcatcaaagtcatctccatgggcaacgccgaagtggggaaaagctgtattataaagcgatactgtgagaaaagattcgtgtctaaatacctggcaacaattggaattgactatggagtcacaaaggtacacgtcagagacagagaaatcaaagttaacatctttgatatggctggacatcccttcttctatgaggttcgaaatgagttttacaaggacacacagggtgtgatactggtctatgatgttgggcagaaagactcctttgacgcccttgatgcgtggctggcagaaatgaagcaagagcttggacctcatggaaacatggaaaatattatatttgtagtttgtgccaacaagattgattgtaccaaacatcgctgtgtagatgaaagtgaaggacgtctttgggctgaaagcaaagggttcctgtactttgaaacttcagcacaaactggagaaggcattaatgagatgttccagaccttttatatatccatagttgatttatgtgaaaatggcgggaaacgccctaccaccaatagcagtgctagtttcaccaaagaacaagcagatgccattcgcagaattcgaaatagtaaagacagttgggacatgctgggagtcaaacctggggcctcaagggatgaagtcaataaagcgtatcggaaacttgctgtgcttcttcaccctgacaaatgtgtagcacctggcagtgaagatgccttcaaagcagttgtgaatgctcggacagccctcctgaaaaacatcaagtag |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - S phase cyclin A-associated protein in the ER - nicotinamide nucleotide adenylyltransferase 2 - NIMA (never in mitosis gene a)-related kinase 6 - tumor-associated calcium signal transducer 1 |