Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
Data sheet of SCAPER-S phase cyclin A-associated protein in the ER Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about SCAPER-S phase cyclin A-associated protein in the ER Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC015212 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | SCAPER |
| Origin species: | Human |
| Product name: | SCAPER-S phase cyclin A-associated protein in the ER Gene |
| Size: | 2ug |
| Accessions: | BC015212 |
| Gene id: | 49855 |
| Gene description: | S phase cyclin A-associated protein in the ER |
| Synonyms: | MSTP063; ZNF291; Zfp291; S phase cyclin A-associated protein in the endoplasmic reticulum; zinc finger protein 291; S-phase cyclin A associated protein in the ER |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgggtctgattgacaaactgtgtgcctgcttcctctcggtgcaaggcccagtggatgagaatcccaagatggccatatttctgcagcatgccgcaggactcttacatgcaatgtgtacactgtgctttgctgtcactggaaggtcatacagcatatttgacaataatcgccaggatcccacagggctgacagctgctcttcaggcaaccgacctggctggagttcttcatatgctctactgtgtcctcttccatggcaccatcttggaccccagcactgccagtcccaaggagaattacactcaaaataccatccaagtggccattcagagtttacgtttcttcaacagctttgcagctcttcatctgcctgcttttcagtctattgtaggggcagagggcttgtcccttgcattccggcacatggccagctccctgctgggccactgcagccaagtctcctgtgaaagcctccttcatgaggtcatcgtctgtgtgggctacttcactgtcaaccacccagataaccaggtgatcgtgcagtccggccgccaccccacagtgctgcagaagctctgccagttgcccttccagtatttcagtgacccacggctgatcaaagtactgttcccttcacttatcgctgcttgttacaacaaccatcagaacaagatcattctggagcaagagatgagctgtgttttactggccactttcattcaggatttggcacagactccaggtcaagcggaaaaccagccttaccaacccaaagggaaatgccttggttcccaagactatcttgagctggctaacagatttcctcagcaggcctgggaagaagctcgacagtttttcttgaaaaaagagaaaaaataa |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - nicotinamide nucleotide adenylyltransferase 2 - NIMA (never in mitosis gene a)-related kinase 6 - tumor-associated calcium signal transducer 1 - tumor-associated calcium signal transducer 2 |