Login to display prices
Login to display prices
SPIB-Spi-B transcription factor (Spi-1/PU.1 related) Gene View larger

SPIB-Spi-B transcription factor (Spi-1/PU.1 related) Gene

PTXBC007921

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of SPIB-Spi-B transcription factor (Spi-1/PU.1 related) Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about SPIB-Spi-B transcription factor (Spi-1/PU.1 related) Gene

Proteogenix catalog: PTXBC007921
Ncbi symbol: SPIB
Product name: SPIB-Spi-B transcription factor (Spi-1/PU.1 related) Gene
Size: 2ug
Accessions: BC007921
Gene id: 6689
Gene description: Spi-B transcription factor (Spi-1/PU.1 related)
Synonyms: SPI-B; transcription factor Spi-B; Spi-B transcription factor (Spi-1/PU.1 related); Spi-B transcription factor
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgctcgccctggaggctgcacagctcgacgggccacacttcagctgtctgtacccagatggcgtcttctatgacctggacagctgcaagcattccagctaccctgattcagagggggctcctgactccctgtgggactggactgtggccccacctgtcccagccaccccctatgaagccttcgacccggcagcagccgcttttagccacccccaggctgcccagctctgctacgaaccccccacctacagccctgcagggaacctcgaactggcccccagcctggaggccccggggcctggcctccccgcataccccacggagaacttcgctagccagaccctggttcccccggcatatgccccgtaccccagccctgtgctatcagaggaggaagacttaccgttggacagccctgccctggaggtctcggacagcgagtcggatgaggccctcgtggctggccccgaggggaagggatccgaggcagggactcgcaagaagctgcgcctgtaccagttcctgctggggctactgacgcgcggggacatgcgtgagtgcgtgtggtgggtggagccaggcgccggcgtcttccagttctcctccaagcacaaggaactcctggcgcgccgctggggccagcagaaggggaaccgcaagcgcatgacctaccagaagctggcgcgcgccctccgaaactacgccaagaccggcgagatccgcaaggtcaagcgcaagctcacctaccagttcgacagcgcgctgctgcctgcagtccgccgggcctga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

30 other products in the same category: