DNAJC15-DnaJ (Hsp40) homolog, subfamily C, member 15 Gene View larger

DNAJC15-DnaJ (Hsp40) homolog, subfamily C, member 15 Gene


New product

113,40 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of DNAJC15-DnaJ (Hsp40) homolog, subfamily C, member 15 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about DNAJC15-DnaJ (Hsp40) homolog, subfamily C, member 15 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC010910
Product type: DNA & cDNA
Ncbi symbol: DNAJC15
Origin species: Human
Product name: DNAJC15-DnaJ (Hsp40) homolog, subfamily C, member 15 Gene
Size: 2ug
Accessions: BC010910
Gene id: 29103
Gene description: DnaJ (Hsp40) homolog, subfamily C, member 15
Synonyms: DNAJD1; HSD18; dnaJ homolog subfamily C member 15; DNAJ domain-containing; DnaJ (Hsp40) homolog, subfamily C, member 15; DnaJ (Hsp40) homolog, subfamily D, member 1; cell growth-inhibiting gene 22 protein; methylation-controlled J protein; DnaJ heat shock protein family (Hsp40) member C15
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggctgcccgtggtgtcatcgctccagttggcgagagtttgcgctacgctgagtacttgcagccctcggccaaacggccagacgccgacgtcgaccagcagggactggtaagaagtttgatagctgtaggactaggtgttgcagctcttgcatttgcaggtcgctacgcatttcggatctggaaacctctagaacaagttatcacagaaactgcaaagaagatttcaactcctagcttttcatcctactataaaggaggatttgaacagaaaatgagtaggcgagaagctggtcttattttaggtgtaagcccatctgctggcaaggctaagattagaacagctcataggagagtcatgattttgaatcacccagataaaggtggatctccttacgtagcagccaaaataaatgaagcaaaagacttgctagaaacaaccaccaaacattga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - alanine-glyoxylate aminotransferase 2-like 2
- protein tyrosine phosphatase, mitochondrial 1
- ubiquitin specific peptidase 6 (Tre-2 oncogene)
- SH3 domain binding glutamic acid-rich protein

Buy DNAJC15-DnaJ (Hsp40) homolog, subfamily C, member 15 Gene now

Add to cart