Login to display prices
Login to display prices
DNAJC15-DnaJ (Hsp40) homolog, subfamily C, member 15 Gene View larger

DNAJC15-DnaJ (Hsp40) homolog, subfamily C, member 15 Gene

PTXBC010910

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of DNAJC15-DnaJ (Hsp40) homolog, subfamily C, member 15 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about DNAJC15-DnaJ (Hsp40) homolog, subfamily C, member 15 Gene

Proteogenix catalog: PTXBC010910
Ncbi symbol: DNAJC15
Product name: DNAJC15-DnaJ (Hsp40) homolog, subfamily C, member 15 Gene
Size: 2ug
Accessions: BC010910
Gene id: 29103
Gene description: DnaJ (Hsp40) homolog, subfamily C, member 15
Synonyms: DNAJD1; HSD18; dnaJ homolog subfamily C member 15; DNAJ domain-containing; DnaJ (Hsp40) homolog, subfamily C, member 15; DnaJ (Hsp40) homolog, subfamily D, member 1; cell growth-inhibiting gene 22 protein; methylation-controlled J protein; DnaJ heat shock protein family (Hsp40) member C15
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggctgcccgtggtgtcatcgctccagttggcgagagtttgcgctacgctgagtacttgcagccctcggccaaacggccagacgccgacgtcgaccagcagggactggtaagaagtttgatagctgtaggactaggtgttgcagctcttgcatttgcaggtcgctacgcatttcggatctggaaacctctagaacaagttatcacagaaactgcaaagaagatttcaactcctagcttttcatcctactataaaggaggatttgaacagaaaatgagtaggcgagaagctggtcttattttaggtgtaagcccatctgctggcaaggctaagattagaacagctcataggagagtcatgattttgaatcacccagataaaggtggatctccttacgtagcagccaaaataaatgaagcaaaagacttgctagaaacaaccaccaaacattga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice