Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
Data sheet of GABARAPL2-GABA(A) receptor-associated protein-like 2 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about GABARAPL2-GABA(A) receptor-associated protein-like 2 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC029601 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | GABARAPL2 |
| Origin species: | Human |
| Product name: | GABARAPL2-GABA(A) receptor-associated protein-like 2 Gene |
| Size: | 2ug |
| Accessions: | BC029601 |
| Gene id: | 11345 |
| Gene description: | GABA(A) receptor-associated protein-like 2 |
| Synonyms: | ATG8; ATG8C; GATE-16; GATE16; GEF-2; GEF2; gamma-aminobutyric acid receptor-associated protein-like 2; GABA(A) receptor-associated protein-like 2; MAP1 light chain 3 related protein; ganglioside expression factor 2; general protein transport factor p16; golgi-associated ATPase enhancer of 16 kDa; GABA type A receptor associated protein like 2 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgaagtggatgttcaaggaggaccactcgctggaacacagatgcgtggagtccgcgaagattcgagcgaaatatcccgacagggttccggtgattgtggaaaaggtctcaggctctcagattgttgacattgacaaacggaagtacttggtcccatctgatatcactgtggctcagttcatgtggatcatcaggaaaaggatccagcttccttctgaaaaggcgatcttcctgtttgtggataagacagtcccacagtccagcctaactatgggacagctttacgagaaggaaaaagatgaagatggattcttatatgtggcctacagcggagagaacacttttggcttctga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - GABA(A) receptor-associated protein-like 2 - protein tyrosine phosphatase, receptor type, S - spondyloepiphyseal dysplasia, late, pseudogene - DnaJ (Hsp40) homolog, subfamily C, member 15 |