Login to display prices
Login to display prices
MOBP-myelin-associated oligodendrocyte basic protein Gene View larger

MOBP-myelin-associated oligodendrocyte basic protein Gene

PTXBC022471

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of MOBP-myelin-associated oligodendrocyte basic protein Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about MOBP-myelin-associated oligodendrocyte basic protein Gene

Proteogenix catalog: PTXBC022471
Ncbi symbol: MOBP
Product name: MOBP-myelin-associated oligodendrocyte basic protein Gene
Size: 2ug
Accessions: BC022471
Gene id: 4336
Gene description: myelin-associated oligodendrocyte basic protein
Synonyms: myelin-associated oligodendrocyte basic protein
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgagtcagaaaccggccaaggagggtcccagactctccaaaaaccagaagtactccgaacacttcagcatacactgctgcccgccgttcaccttcctcaattccaagaaggagatagtggatcggaaatacagcatctgtaagagcggctgcttctaccagaagaaagaggaggactggatctgctgcgcctgccagaagaccagattgaaaaggaagatcaggccaaccccaaagaagaagtga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

30 other products in the same category: