Login to display prices
Login to display prices
PCYT2-phosphate cytidylyltransferase 2, ethanolamine Gene View larger

PCYT2-phosphate cytidylyltransferase 2, ethanolamine Gene

PTXBC000351

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of PCYT2-phosphate cytidylyltransferase 2, ethanolamine Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about PCYT2-phosphate cytidylyltransferase 2, ethanolamine Gene

Proteogenix catalog: PTXBC000351
Ncbi symbol: PCYT2
Product name: PCYT2-phosphate cytidylyltransferase 2, ethanolamine Gene
Size: 2ug
Accessions: BC000351
Gene id: 5833
Gene description: phosphate cytidylyltransferase 2, ethanolamine
Synonyms: ethanolamine-phosphate cytidylyltransferase; CTP:phosphoethanolamine cytidylyltransferase; phosphorylethanolamine transferase; phosphate cytidylyltransferase 2, ethanolamine
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgatccggaacgggcgcggggctgcaggcggcgcagagcagccgggcccggggggcaggcgcgccgtgagggtgtggtgcgatggctgctatgacatggtgcattacggccactccaaccagctgcgccaggcacgggccatgggtgactacctcatcgtaggcgtgcacaccgatgaggagatcgccaagcacaaggggcccccggtgttcactcaggaggagagatacaagatggtgcaggccatcaaatgggtggacgaggtggtgccagcggctccctacgtcactacactagagaccctggacaaatacaactgtgacttctgtgttcacggcaatgacatcaccctgactgtagatggccgggacacctatgaggaagtaaagcaggctgggaggtacagagaatgcaagcgcacgcaaggggtgtccaccacagacctcgtgggccgcatgctgctggtaaccaaagcccatcacagcagccaggagatgtcctctgagtaccgggagtatgcagacagttttggcaagtgccctggtgggcggaacccctggaccggggtatcccagttcctgcagacatctcagaagatcatccagtttgcttctgggaaggagccccagccaggggagacagtcatctatgtggctggtgccttcgacctgttccacatcgggcatgtggacttcctggagaaggtgcacaggctggcagagaggccctacatcatcgcgggcttacactttgaccaggaggtcaatcactacaaggggaagaactaccccatcatgaatctgcatgaacggactctgagcgtgctggcctgccggtacgtgtcagaagtggtgattggagccccgtacgcggtcacagcagagctcctaagtcacttcaaggtggacctggtgtgtcacggcaagacagaaattatccctgacagggatggctccgacccataccaggagcccaagagaaggggcatcttccgtcagattgacagtggcagcaacctcaccacagacctcatcgtccagcggatcatcaccaacaggttggagtatgaggcgcgaaaccagaagaaggaagccaaggagctggccttcctggaggctgccaggcagcaggcggcacagcccctgggggagcgcgatggtgacttctaa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

30 other products in the same category: