DRG2-developmentally regulated GTP binding protein 2 Gene View larger

DRG2-developmentally regulated GTP binding protein 2 Gene


New product

121,50 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of DRG2-developmentally regulated GTP binding protein 2 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about DRG2-developmentally regulated GTP binding protein 2 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC000493
Product type: DNA & cDNA
Ncbi symbol: DRG2
Origin species: Human
Product name: DRG2-developmentally regulated GTP binding protein 2 Gene
Size: 2ug
Accessions: BC000493
Gene id: 1819
Gene description: developmentally regulated GTP binding protein 2
Synonyms: developmentally-regulated GTP-binding protein 2; developmentally regulated GTP binding protein 2
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggggatcttagagaagatctcggagatcgagaaggagatcgctcggacacagaagaacaaggccactgagtatcatctgggcctgctgaaagctaagctcgccaagtatcgggcccagctcctggaaccgtccaaatcggcctcgtccaaaggagagggctttgatgtcatgaagtcgggtgatgcccgtgtggcgctgattggatttccctctgtgggtaagtccacattcttgagtctgatgacctccacggccagcgaggcagcgtcctatgagttcaccactctgacgtgtattcctggggtcattgaatacaaaggtgccaacatccagctcctggaccttcctggaatcattgaaggcgcagcccaaggaaaaggccgtggccggcaggtgatcgctgtggcgcgcacggctgacgtcatcatcatgatgctggatgccaccaagggagaggtgcagaggtctctgctggagaaggagctggagtctgtgggcatccgcctcaacaagcacaagcctaacatctacttcaagcccaagaaaggtggtggcatctcctttaactcgacagtcatgctgacccagtgctcggaaaagctggtgcagctcatcctgcacgaatacaagatcttcaatgcagaagtgcttttccgagaagactgctccccggacgagttcatcgatgtgatcgtgggcaaccgggtgtacatgccctgcctgtatgtttataacaaaatcgaccagatctccatggaagaggtggaccgcctggcccgaaaacccaacagtgtggtcatcagctgcggcatgaagctgaacctggactatctgctggagatgctttgggagtacttggccctgacctgcatctacaccaagaagagaggacagaggccagacttcacagacgccatcattctccggaaaggggcctcagtggagcacgtgtgccaccgcatccaccggtcactcgccagccagttcaagtacgccctggtgtggggcaccagcaccaagtacagtccgcagcgggtgggcctgacccacaccatggagcatgaggacgtcatccagatcgtgaagaagtaa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - phosphate cytidylyltransferase 2, ethanolamine
- SH3-domain binding protein 5 (BTK-associated)
- cell division cycle 20 homolog (S. cerevisiae)
- protein disulfide isomerase family A, member 3

Buy DRG2-developmentally regulated GTP binding protein 2 Gene now

Add to cart