Cart 29 Product Products 8 392,05 € (empty)
-
1 x ZNF577-zin...121,50 € -
-
-
-
1 x TWF2-twinf...121,50 € -
1 x NME4-non-m...113,40 € -
1 x TMLHE-trim...121,50 € -
1 x PPIL5-pept...121,50 € -
1 x Donkey...269,00 € -
-
-
1 x PACRGL-PAR...113,40 € -
1 x CAPNS1-cal...121,50 € -
1 x RGS17-regu...113,40 € -
-
-
-
1 x KLK10-kall...121,50 € -
1 x C14orf139-...113,40 € -
1 x RFESD-Ries...113,40 € -
-
-
-
-
-
1 x ETNK2-etha...121,50 € -
1 x CPA1-carbo...121,50 € -
1 x IL29-inter...113,40 € -
No products
To be determined Shipping
8 392,05 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 29 items in your cart. There is 1 item in your cart.
Total products (tax excl.) 8 392,05 €
Total shipping (tax excl.) To be determined
Total (tax excl.) 8 392,05 €
View larger 
Data sheet of DNAJC28-DnaJ (Hsp40) homolog, subfamily C, member 28 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about DNAJC28-DnaJ (Hsp40) homolog, subfamily C, member 28 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC029509 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | DNAJC28 |
| Origin species: | Human |
| Product name: | DNAJC28-DnaJ (Hsp40) homolog, subfamily C, member 28 Gene |
| Size: | 2ug |
| Accessions: | BC029509 |
| Gene id: | 54943 |
| Gene description: | DnaJ (Hsp40) homolog, subfamily C, member 28 |
| Synonyms: | C21orf55; C21orf78; dnaJ homolog subfamily C member 28; DnaJ (Hsp40) homolog, subfamily C, member 28; DnaJ heat shock protein family (Hsp40) member C28 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgaatacaatgtatgtgatgatggctcagatcttaagatctcacctgataaaggctacagtgattcctaatcgagtgaaaatgcttccatattttggtatcattagaaatagaatgatgtcaacccataaatccaaaaagaagatcagagaatattatagactgctgaacgtggaggaaggatgctctgcagatgaagtcagggaatcttttcataagcttgccaagcaatatcatcctgacagtggctctaatactgctgattctgcaacatttataaggattgaaaaagcttatagaaaggtgctctcccatgtgatagaacaaacaaatgccagtcagagtaaaggtgaagaagaagaagatgtagaaaaattcaaatataaaacaccccaacaccgacattatttaagttttgaaggtattggttttgggactccaactcaacgagagaagcattataggcaatttagggcagaccgtgctgctgaacaagtgatggaatatcaaaagcagaaactacaaagccagtattttcctgatagtgtaattgttaaaaatataagacagagcaaacagcaaaagataacgcaagctatagaacgtttagtggaggacctcattcaagaatccatggcaaaaggagactttgacaatctcagtgggaaaggaaaacgtctgaaaaagttttctgactgttcttacattgatcccatgactcacaacctgaaccgaatactgatcgataatggataccaaccagaatggatccttaagcaaaaggaaataagcgatactattgagcaactcagagaggcaattttagtgtctaggaaaaaacttgggaatccaatgacaccaactgaaaagaaacagtggaaccatgtttgtgagcagtttcaagaaaacatcagaaaattaaacaagcgaattaatgattttaattgttcccatcctgaccaggcaaaaagtccattttga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - growth hormone inducible transmembrane protein - DnaJ (Hsp40) homolog, subfamily B, member 11 - developmentally regulated GTP binding protein 2 - phosphate cytidylyltransferase 2, ethanolamine |