Login to display prices
Login to display prices
DNAJC28-DnaJ (Hsp40) homolog, subfamily C, member 28 Gene View larger

DNAJC28-DnaJ (Hsp40) homolog, subfamily C, member 28 Gene

PTXBC029509

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of DNAJC28-DnaJ (Hsp40) homolog, subfamily C, member 28 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about DNAJC28-DnaJ (Hsp40) homolog, subfamily C, member 28 Gene

Proteogenix catalog: PTXBC029509
Ncbi symbol: DNAJC28
Product name: DNAJC28-DnaJ (Hsp40) homolog, subfamily C, member 28 Gene
Size: 2ug
Accessions: BC029509
Gene id: 54943
Gene description: DnaJ (Hsp40) homolog, subfamily C, member 28
Synonyms: C21orf55; C21orf78; dnaJ homolog subfamily C member 28; DnaJ (Hsp40) homolog, subfamily C, member 28; DnaJ heat shock protein family (Hsp40) member C28
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgaatacaatgtatgtgatgatggctcagatcttaagatctcacctgataaaggctacagtgattcctaatcgagtgaaaatgcttccatattttggtatcattagaaatagaatgatgtcaacccataaatccaaaaagaagatcagagaatattatagactgctgaacgtggaggaaggatgctctgcagatgaagtcagggaatcttttcataagcttgccaagcaatatcatcctgacagtggctctaatactgctgattctgcaacatttataaggattgaaaaagcttatagaaaggtgctctcccatgtgatagaacaaacaaatgccagtcagagtaaaggtgaagaagaagaagatgtagaaaaattcaaatataaaacaccccaacaccgacattatttaagttttgaaggtattggttttgggactccaactcaacgagagaagcattataggcaatttagggcagaccgtgctgctgaacaagtgatggaatatcaaaagcagaaactacaaagccagtattttcctgatagtgtaattgttaaaaatataagacagagcaaacagcaaaagataacgcaagctatagaacgtttagtggaggacctcattcaagaatccatggcaaaaggagactttgacaatctcagtgggaaaggaaaacgtctgaaaaagttttctgactgttcttacattgatcccatgactcacaacctgaaccgaatactgatcgataatggataccaaccagaatggatccttaagcaaaaggaaataagcgatactattgagcaactcagagaggcaattttagtgtctaggaaaaaacttgggaatccaatgacaccaactgaaaagaaacagtggaaccatgtttgtgagcagtttcaagaaaacatcagaaaattaaacaagcgaattaatgattttaattgttcccatcctgaccaggcaaaaagtccattttga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

30 other products in the same category: