NMNAT1-nicotinamide nucleotide adenylyltransferase 1 Gene View larger

NMNAT1-nicotinamide nucleotide adenylyltransferase 1 Gene


New product

121,50 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of NMNAT1-nicotinamide nucleotide adenylyltransferase 1 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about NMNAT1-nicotinamide nucleotide adenylyltransferase 1 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC014943
Product type: DNA & cDNA
Ncbi symbol: NMNAT1
Origin species: Human
Product name: NMNAT1-nicotinamide nucleotide adenylyltransferase 1 Gene
Size: 2ug
Accessions: BC014943
Gene id: 64802
Gene description: nicotinamide nucleotide adenylyltransferase 1
Synonyms: LCA9; NMNAT; PNAT1; nicotinamide/nicotinic acid mononucleotide adenylyltransferase 1; NMN adenylyltransferase 1; NMN/NaMN adenylyltransferase 1; NaMN adenylyltransferase 1; nicotinamide mononucleotide adenylyltransferase 1; nicotinate-nucleotide adenylyltransferase 1; pyridine nucleotide adenylyltransferase 1; nicotinamide nucleotide adenylyltransferase 1
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggaaaattccgagaagactgaagtggttctccttgcttgtggttcattcaatcccatcaccaacatgcacctcaggttgtttgagctggccaaggactacatgaatggaacaggaaggtacacagttgtcaaaggcatcatctctcctgttggtgatgcctacaagaagaaaggactcattcctgcctatcaccgggtcatcatggcagaacttgctaccaagaattctaaatgggtggaagttgatacatgggaaagtcttcagaaggagtggaaagagactctgaaggtgctaagacaccatcaagagaaattggaggctagtgactgtgatcaccagcagaactcacctactctagaaaggcctggaaggaagaggaagtggactgaaacacaagattctagtcaaaagaaatccctagagccaaaaacaaaagctgtgccaaaggtcaagctgctgtgtggggcagatttattggagtcctttgctgttcccaatttgtggaagagtgaagacatcacccaaatcgtggccaactatgggctcatatgtgttactcgggctggaaatgatgctcagaagtttatctatgaatcggatgtgctgtggaaacaccggagcaacattcacgtggtgaatgaatggatcgctaatgacatctcatccacaaaaatccggagagccctcagaaggggccagagcattcgctacttggtaccagatcttgtccaagaatacattgaaaagcataatttgtacagctctgagagtgaagacaggaatgctggggtcatcctggcccctttgcagagaaacactgcagaagctaagacatag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - DnaJ (Hsp40) homolog, subfamily C, member 28
- growth hormone inducible transmembrane protein
- DnaJ (Hsp40) homolog, subfamily B, member 11
- developmentally regulated GTP binding protein 2

Buy NMNAT1-nicotinamide nucleotide adenylyltransferase 1 Gene now

Add to cart