Login to display prices
Login to display prices
ZNF581-zinc finger protein 581 Gene View larger

ZNF581-zinc finger protein 581 Gene

PTXBC001219

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of ZNF581-zinc finger protein 581 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about ZNF581-zinc finger protein 581 Gene

Proteogenix catalog: PTXBC001219
Ncbi symbol: ZNF581
Product name: ZNF581-zinc finger protein 581 Gene
Size: 2ug
Accessions: BC001219
Gene id: 51545
Gene description: zinc finger protein 581
Synonyms: HSPC189; zinc finger protein 581
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgctggtgctgccatccccctgccctcagcctctggcattttcctccgttgagaccatggagggccctccccgtcggacttgccgctccccagaacctggaccttcctcctccatcggatctccccaggcttcatctcctccaaggcccaaccactacctgcttattgacactcagggtgtcccctacacagtgctggtggacgaggagtcacagagggagccaggggccagtggggctccaggccagaaaaagtgctacagctgccccgtgtgctcaagggtcttcgagtacatgtcctaccttcagcgacacagcatcacccactcggaggtaaagcccttcgagtgtgacatctgtgggaaggcattcaagcgcgccagccacttggcacggcaccattccattcacctggcgggtggtgggcggccccacggctgcccgctctgccctcgccgcttccgggatgcgggtgagctggcccagcacagccgggtgcactctggggagcgcccgtttcagtgtccacactgccctcgccgctttatggagcagaacacactgcagaaacacacgcggtggaagcatccatga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

30 other products in the same category: