THAP6-THAP domain containing 6 Gene View larger

THAP6-THAP domain containing 6 Gene


New product

113,40 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of THAP6-THAP domain containing 6 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about THAP6-THAP domain containing 6 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC022989
Product type: DNA & cDNA
Ncbi symbol: THAP6
Origin species: Human
Product name: THAP6-THAP domain containing 6 Gene
Size: 2ug
Accessions: BC022989
Gene id: 152815
Gene description: THAP domain containing 6
Synonyms: THAP domain-containing protein 6; THAP domain containing 6
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggtgaaatgctgctccgccattggatgtgcttctcgctgcttgccaaattcgaagttaaaaggactgacatttcacgtattccccacagatgaaaacatcaaaaggaaatgggtattagcaatgaaaagacttgatgtgaatgcagccggcatttgggagcctaaaaaaggagatgtgttgtgttcgaggcactttaagaagacagattttgacagaagtgctccaaatattaaactgaaacctggagtcataccttctatctttgattctccatatcacctacaggggaaaagagaaaaacttcattgtagaaaaaacttcaccctcaaaaccgttccagccactaactacaatcaccatcttgttggtgcttcctcatgtattgaagaattccaatcccagttcatttttgaacatagctacagtgtaatggacagtccaaagaaacttaagcataaattagatcatgtgatcggcgagctagaggatacaaaggaaagtctacggaatgttttagaccgagaaaaacgttttcagaaatcattgaggaagacaatcagggaattaaaggatgaatgtctgatcagccaagaaacagcaaatagactggacactttctgttgggactgttgtcaggagagcatagaacaggactatatttcatga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - MAM domain containing 2
- zinc finger protein 511
- THAP domain containing 4
- zinc finger protein 688

Buy THAP6-THAP domain containing 6 Gene now

Add to cart