MAMDC2-MAM domain containing 2 Gene View larger

MAMDC2-MAM domain containing 2 Gene


New product

113,40 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of MAMDC2-MAM domain containing 2 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about MAMDC2-MAM domain containing 2 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC015417
Product type: DNA & cDNA
Ncbi symbol: MAMDC2
Origin species: Human
Product name: MAMDC2-MAM domain containing 2 Gene
Size: 2ug
Accessions: BC015417
Gene id: 256691
Gene description: MAM domain containing 2
Synonyms: MAM domain-containing protein 2; MAM domain containing 1; MAM domain-containing proteoglycan; mamcan; MAM domain containing 2
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgcaagctgaaatcacctttaagaagcccatgcctaccaaggtggttttcatgagcctatgcaaaagtttctgggactgtgggcttgtagccctggatgacattacaatacaattgggaagctgctcatcttcagagaaacttccacctccacctggagagtgtactttcgagcaagatgaatgtacatttactcaggagaaaagaaaccggagcagctggcacaggaggaggggagaaactcccacttcctacacaggaccaaagggagatcacactactggggtaggctactacatgtacattgaggcctcccatatggtgtatggacaaaaagcacgcctcttgtccaggcctctgcgaggagtctctggaaaacactgcttgacctttttctaccacatgtatggagggggcactggcctgctgagtgtttatctgaaaaaggaagaagacagtgaagagtccctcttatggaggagaagaggtgaacagagcatttcctggctacgagcactgattgaatacagctgtgagaggcaacaccagataatttttgaagccattcgaggagtatcaataagaagtgatattgccattgatgatgttaaatttcaggcaggaccctgtggagaaatggaagatacaactcaacaatcatcaggatattctgaggacttaaatgaaattgagtattaa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - zinc finger protein 511
- THAP domain containing 4
- zinc finger protein 688
- ring finger protein 148

Buy MAMDC2-MAM domain containing 2 Gene now

Add to cart