Login to display prices
Login to display prices
ZNF511-zinc finger protein 511 Gene View larger

ZNF511-zinc finger protein 511 Gene

PTXBC019897

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of ZNF511-zinc finger protein 511 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about ZNF511-zinc finger protein 511 Gene

Proteogenix catalog: PTXBC019897
Ncbi symbol: ZNF511
Product name: ZNF511-zinc finger protein 511 Gene
Size: 2ug
Accessions: BC019897
Gene id: 118472
Gene description: zinc finger protein 511
Synonyms: zinc finger protein 511
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgcagttgccccccgcgctgtgcgcccgcctcgctgcggggcccggggcggcggagccactgcctgtagagcgggatcccgcggctggggccgcgccctttcgcttcgttgcgcgccccgtgcgcttcccgcgggagcaccagttcttcgaggatggggacgtgcagcgccacctctacctccaggacgtgatcatgcaggtggccgacgtgcctgagaagcccagggtgcccgcgtttgcctgccaggtggccggctgctgccaggtgttcgatgccctggacgactacgagcaccactaccacacgctgcacggaaatgtttgctccttttgcaagcgggccttcccttccggacacctgctggacgcccacatcctggagtggcacgattcgctcttccagatcctgtctgagaggcaggacatgtatcagtgcttggtagaaggctgcacagagaagttcaagaccagcagagaccggaaggatcacatggtgaggatgcacctgtaccccgcggacttccggtttgataagccaaagaaaagcagaagcccagcctcagcagaagccccaggggacagtggagagcggtcagaaggggaggccatggaaatctgctctgagcctgtggcagcctcccctgcaccggcaggtgagaggcggatctacagacatagaataccctctaccatctgctttggtcagggtgccgctcgaggatttaaaagcaacaagaagaaaaccaaacaatgctga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

30 other products in the same category: