ZNF511-zinc finger protein 511 Gene View larger

ZNF511-zinc finger protein 511 Gene

PTXBC019897

New product

113,40 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of ZNF511-zinc finger protein 511 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about ZNF511-zinc finger protein 511 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC019897
Product type: DNA & cDNA
Ncbi symbol: ZNF511
Origin species: Human
Product name: ZNF511-zinc finger protein 511 Gene
Size: 2ug
Accessions: BC019897
Gene id: 118472
Gene description: zinc finger protein 511
Synonyms: zinc finger protein 511
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgcagttgccccccgcgctgtgcgcccgcctcgctgcggggcccggggcggcggagccactgcctgtagagcgggatcccgcggctggggccgcgccctttcgcttcgttgcgcgccccgtgcgcttcccgcgggagcaccagttcttcgaggatggggacgtgcagcgccacctctacctccaggacgtgatcatgcaggtggccgacgtgcctgagaagcccagggtgcccgcgtttgcctgccaggtggccggctgctgccaggtgttcgatgccctggacgactacgagcaccactaccacacgctgcacggaaatgtttgctccttttgcaagcgggccttcccttccggacacctgctggacgcccacatcctggagtggcacgattcgctcttccagatcctgtctgagaggcaggacatgtatcagtgcttggtagaaggctgcacagagaagttcaagaccagcagagaccggaaggatcacatggtgaggatgcacctgtaccccgcggacttccggtttgataagccaaagaaaagcagaagcccagcctcagcagaagccccaggggacagtggagagcggtcagaaggggaggccatggaaatctgctctgagcctgtggcagcctcccctgcaccggcaggtgagaggcggatctacagacatagaataccctctaccatctgctttggtcagggtgccgctcgaggatttaaaagcaacaagaagaaaaccaaacaatgctga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - THAP domain containing 4
- zinc finger protein 688
- ring finger protein 148
- brix domain containing 1

Buy ZNF511-zinc finger protein 511 Gene now

Add to cart