HS1BP3-HCLS1 binding protein 3 Gene View larger

HS1BP3-HCLS1 binding protein 3 Gene


New product

113,40 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of HS1BP3-HCLS1 binding protein 3 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about HS1BP3-HCLS1 binding protein 3 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC027947
Product type: DNA & cDNA
Ncbi symbol: HS1BP3
Origin species: Human
Product name: HS1BP3-HCLS1 binding protein 3 Gene
Size: 2ug
Accessions: BC027947
Gene id: 64342
Gene description: HCLS1 binding protein 3
Synonyms: ETM2; HS1-BP3; HCLS1-binding protein 3; HS1-binding protein 3; HSP1BP-3; HCLS1 binding protein 3
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgcagtccccggcggtgctcgtcacctccaggcgacttcagaatgcccacactggcctcgacctgactgtgccccagcaccaggaggtacggggcaagatgatgtctggacacgtggagtaccagatcctggtggtgacccgtctggctgcgttcaagtcggccaagcacaggcccgaggatgtcgtccagttcttggtctccaaaaagtacagcgagattgaggagttttaccagaaactgagcagtcgttatgcagcagccagcctccccccactacccaggaaggtcctgtttgttggggagtctgacatccgggagaggagagccgtgttcaatgagatcctgcgctgtgtctccaaggatgccgagttggcaggcagcccagagctgctagagttcttaggtaccagatccccaggggctgcagggctcaccagcagagattcctctgtcctggatggcacagacagtcagacagggaatgatgaagaggctttcgacttttttgaggagcaagaccaagtggcagaagagggtccgcccgtccagagcctgaagggcgaggatgctgaggaatccttggaggaggaggaggcgctggaccctctgggcattatgcggttggtctcctgttgttga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - THAP domain containing 6
- MAM domain containing 2
- zinc finger protein 511
- THAP domain containing 4

Buy HS1BP3-HCLS1 binding protein 3 Gene now

Add to cart