AK1-adenylate kinase 1 Gene View larger

AK1-adenylate kinase 1 Gene

PTXBC001116

New product

113,40 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of AK1-adenylate kinase 1 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about AK1-adenylate kinase 1 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC001116
Product type: DNA & cDNA
Ncbi symbol: AK1
Origin species: Human
Product name: AK1-adenylate kinase 1 Gene
Size: 2ug
Accessions: BC001116
Gene id: 203
Gene description: adenylate kinase 1
Synonyms: HTL-S-58j; adenylate kinase isoenzyme 1; ATP-AMP transphosphorylase 1; ATP:AMP phosphotransferase; adenylate monophosphate kinase; myokinase; testis secretory sperm binding protein Li 58j; adenylate kinase 1
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggaagagaagctgaagaaaaccaatatcatctttgtggtgggtgggcctggctcagggaagggcacccagtgtgagaagatcgtgcagaagtatggctacacccacctctccaccggggacctcctgcggtccgaggtcagctcaggctcggccaggggcaagaagctgtcggaaatcatggagaaggggcagctggttccactggagacagtgttggacatgctccgggatgccatggtggccaaagtcaatacttccaaaggcttcctgattgatggctacccgcgggaggtgcagcaaggagaagagtttgagcgacggattggacagcccacactgctgctgtatgtggacgcaggccctgagaccatgacccagcggctcttgaaacgtggagagaccagcgggcgtgtggacgacaatgaggagaccatcaaaaagcggctggagacctattacaaggccacagaacccgtcatcgccttctatgagaaacgtggcattgtgcgcaaggtcaacgctgagggctccgtggacagtgtcttctcccaggtctgcacccacctggacgccctaaagtag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - phosducin-like 2
- sorting nexin 11
- Obg-like ATPase 1
- CD300a molecule

Buy AK1-adenylate kinase 1 Gene now

Add to cart