METTL10-methyltransferase like 10 Gene View larger

METTL10-methyltransferase like 10 Gene


New product

113,40 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of METTL10-methyltransferase like 10 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about METTL10-methyltransferase like 10 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC026167
Product type: DNA & cDNA
Ncbi symbol: METTL10
Origin species: Human
Product name: METTL10-methyltransferase like 10 Gene
Size: 2ug
Accessions: BC026167
Gene id: 399818
Gene description: methyltransferase like 10
Synonyms: protein-lysine N-methyltransferase METTL10; C10orf138; methyltransferase-like protein 10; methyltransferase like 10
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgagctcgggcgctgacggcggcggtggcgctgcggtggcggcgcggtcggacaagggcagtcccggggaggacggtttcgtcccgtcggcgctggggacccgcgagcattgggatgctgtctatgagagagaactgcaaactttccgagaatatggagatacaggtgaaatctggtttggagaagagagtatgaatcgactaataaggtggatgcagaaacacaagattccactggatgcttcagtgcttgatattggaactggaaatggtgttttcctggttgaacttgcaaaatttggtttctctaatattactggaattgattactctccttctgcaattcagctttctggaagtattatagaaaaagaaggtttatctaacattaagttaaaggtagaagactttttgaatctctccacacagctgtctggatttcatatttgtattgacaaagggacttttgatgccataagccttaatcctgacaatgcaattgagaagaggaagcaatatgtgaaatctctctccagggtgttgaaagtaaaaggctttttttctaataacgtcatgtaa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - fibroblast growth factor 19
- transmembrane protein 147
- neuronal growth regulator 1
- MACRO domain containing 1

Buy METTL10-methyltransferase like 10 Gene now

Add to cart