Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
Data sheet of PTGDS-prostaglandin D2 synthase 21kDa (brain) Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about PTGDS-prostaglandin D2 synthase 21kDa (brain) Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC005939 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | PTGDS |
| Origin species: | Human |
| Product name: | PTGDS-prostaglandin D2 synthase 21kDa (brain) Gene |
| Size: | 2ug |
| Accessions: | BC005939 |
| Gene id: | 5730 |
| Gene description: | prostaglandin D2 synthase 21kDa (brain) |
| Synonyms: | L-PGDS; LPGDS; PDS; PGD2; PGDS; PGDS2; prostaglandin-H2 D-isomerase; PGD2 synthase; beta-trace protein; cerebrin-28; glutathione-independent PGD synthase; glutathione-independent PGD synthetase; lipocalin-type prostaglandin D synthase; prostaglandin D synthase; prostaglandin D2 synthase 21kDa (brain); testis tissue sperm-binding protein Li 63n; prostaglandin D2 synthase |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggctactcatcacacgctgtggatgggactggccctgctgggggtgctgggcgacctgcaggcagcaccggaggcccaggtctccgtgcagcccaacttccagcaggacaagttcctggggcgctggttcagcgcgggcctcgcctccaactcgagctggctccgggagaagaaggcggcgttgtccatgtgcaagtctgtggtggcccctgccacggatggtggcctcaacctgacctccaccttcctcaggaaaaaccagtgtgagacccgaaccatgctgctgcagcccgcggggtccctcggctcctacagctaccggagtccccactggggcagcacctactccgtgtcagtggtggagaccgactacgaccagtacgcgctgctgtacagccagggcagcaagggccctggcgaggacttccgcatggccaccctctacagccgaacccagacccccagggctgagttaaaggagaaattcaccgccttctgcaaggcccagggcttcacagaggataccattgtcttcctgccccaaaccgataagtgcatgacggaacaatag |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - ankyrin repeat and SOCS box-containing 6 - glutamate decarboxylase 1 (brain, 67kDa) - U2 small nuclear RNA auxiliary factor 1 - transmembrane and coiled-coil domains 6 |