PTGDS-prostaglandin D2 synthase 21kDa (brain) Gene View larger

PTGDS-prostaglandin D2 synthase 21kDa (brain) Gene

PTXBC005939

New product

113,40 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of PTGDS-prostaglandin D2 synthase 21kDa (brain) Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about PTGDS-prostaglandin D2 synthase 21kDa (brain) Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC005939
Product type: DNA & cDNA
Ncbi symbol: PTGDS
Origin species: Human
Product name: PTGDS-prostaglandin D2 synthase 21kDa (brain) Gene
Size: 2ug
Accessions: BC005939
Gene id: 5730
Gene description: prostaglandin D2 synthase 21kDa (brain)
Synonyms: L-PGDS; LPGDS; PDS; PGD2; PGDS; PGDS2; prostaglandin-H2 D-isomerase; PGD2 synthase; beta-trace protein; cerebrin-28; glutathione-independent PGD synthase; glutathione-independent PGD synthetase; lipocalin-type prostaglandin D synthase; prostaglandin D synthase; prostaglandin D2 synthase 21kDa (brain); testis tissue sperm-binding protein Li 63n; prostaglandin D2 synthase
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggctactcatcacacgctgtggatgggactggccctgctgggggtgctgggcgacctgcaggcagcaccggaggcccaggtctccgtgcagcccaacttccagcaggacaagttcctggggcgctggttcagcgcgggcctcgcctccaactcgagctggctccgggagaagaaggcggcgttgtccatgtgcaagtctgtggtggcccctgccacggatggtggcctcaacctgacctccaccttcctcaggaaaaaccagtgtgagacccgaaccatgctgctgcagcccgcggggtccctcggctcctacagctaccggagtccccactggggcagcacctactccgtgtcagtggtggagaccgactacgaccagtacgcgctgctgtacagccagggcagcaagggccctggcgaggacttccgcatggccaccctctacagccgaacccagacccccagggctgagttaaaggagaaattcaccgccttctgcaaggcccagggcttcacagaggataccattgtcttcctgccccaaaccgataagtgcatgacggaacaatag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - ankyrin repeat and SOCS box-containing 6
- glutamate decarboxylase 1 (brain, 67kDa)
- U2 small nuclear RNA auxiliary factor 1
- transmembrane and coiled-coil domains 6

Buy PTGDS-prostaglandin D2 synthase 21kDa (brain) Gene now

Add to cart