GAD1-glutamate decarboxylase 1 (brain, 67kDa) Gene View larger

GAD1-glutamate decarboxylase 1 (brain, 67kDa) Gene


New product

113,40 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of GAD1-glutamate decarboxylase 1 (brain, 67kDa) Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about GAD1-glutamate decarboxylase 1 (brain, 67kDa) Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC002815
Product type: DNA & cDNA
Ncbi symbol: GAD1
Origin species: Human
Product name: GAD1-glutamate decarboxylase 1 (brain, 67kDa) Gene
Size: 2ug
Accessions: BC002815
Gene id: 2571
Gene description: glutamate decarboxylase 1 (brain, 67kDa)
Synonyms: CPSQ1; GAD; SCP; glutamate decarboxylase 1; 67 kDa glutamic acid decarboxylase; GAD-67; glutamate decarboxylase 1 (brain, 67kDa); glutamate decarboxylase 67 kDa isoform
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggcgtcttcgaccccatcttcgtccgcaacctcctcgaacgcgggagcggaccccaataccactaacctgcgccccacaacgtacgatacctggtgcggcgtggcccatggatgcaccagaaaactggggctcaagatctgcggcttcttgcaaaggaccaacagcctggaagagaagagtcgccttgtgagtgccttcaaggagaggcaatcctccaagaacctgctttcctgtgaaaacagcgaccgggatgcccgcttccggcgcacagagactgacttctctaatctgtttgctagagatctgcttccggctaagaacggtgaggagcaaaccgtgcaattcctcctggaagtggtggacatactcctcaactatgtccgcaagacatttgatcgctccaccaaggtgctggactttcatcacccacaccagttgctggaaggcatggagggcttcaacttggagctctctgaccaccccgagtccctggagcagatcctggttgactgcagagacaccttgaagtatggggttcgcacaggtcatcctcgatttttcaaccagctctccactggattggatattattggcctagctggagaatggctgacatcaacggccaataccaacatgccatcagacatgagggagtgttggttgctacggtga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - U2 small nuclear RNA auxiliary factor 1
- transmembrane and coiled-coil domains 6
- hippocampus abundant transcript-like 1
- spondin 2, extracellular matrix protein

Buy GAD1-glutamate decarboxylase 1 (brain, 67kDa) Gene now

Add to cart