Login to display prices
Login to display prices
TMCO6-transmembrane and coiled-coil domains 6 Gene View larger

TMCO6-transmembrane and coiled-coil domains 6 Gene

PTXBC001910

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of TMCO6-transmembrane and coiled-coil domains 6 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about TMCO6-transmembrane and coiled-coil domains 6 Gene

Proteogenix catalog: PTXBC001910
Ncbi symbol: TMCO6
Product name: TMCO6-transmembrane and coiled-coil domains 6 Gene
Size: 2ug
Accessions: BC001910
Gene id: 55374
Gene description: transmembrane and coiled-coil domains 6
Synonyms: PRO1580; transmembrane and coiled-coil domain-containing protein 6; transmembrane and coiled-coil domains 6
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgctacaaatgttgcaacctggcccaaagctcaaccctggggtcgctgtggagtttgcctggtgccttcattacatcatctgcagccaggtcagcaatcctctgctcattggccatggggctctgtctactctggggttgctgctgttggacttggctggggctgtccagaaaagcgaggatgcaggactggagctgctggcatgccccgtgcttcgatgtctaagcaacctgctaactgaggcagcagtggagactgtgggagggcaaatgcagctcagagatgagcgtgttgtggcagccttatttatccttctgcagttctttttccagaaacagcccagtctgctccctgagggcctttggctcctcaacaacctcactgcaaacagtcctagtttctgtacctccttgctctccctggatctgattgagcctctcttacagctgttgccagtatctaacgtggtgagcgtaatggtgctcacagttctgtgcaatgttgcagaaaagggtcctgcttactgccagcggctgtggccagggcccctgcttcccgccttgctgcacacactagccttttctgacactgaagtagtaggccagagtttggagctgctgcatctgctgttcctgtatcagccagaggctgttcaggtcttcctgcagcagtcagggctgcaagccctggaaaggcatcaggaagaggcccagctccaggatcgtgtgtatgctctccagcagacagctcttcaagggtga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

30 other products in the same category: