RTCD1-RNA terminal phosphate cyclase domain 1 Gene View larger

RTCD1-RNA terminal phosphate cyclase domain 1 Gene


New product

121,50 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of RTCD1-RNA terminal phosphate cyclase domain 1 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about RTCD1-RNA terminal phosphate cyclase domain 1 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC012604
Product type: DNA & cDNA
Ncbi symbol: RTCD1
Origin species: Human
Product name: RTCD1-RNA terminal phosphate cyclase domain 1 Gene
Size: 2ug
Accessions: BC012604
Gene id: 8634
Gene description: RNA terminal phosphate cyclase domain 1
Synonyms: RTCD1; RPC; RTC1; RNA 3'-terminal phosphate cyclase; RNA terminal phosphate cyclase domain 1; RNA terminal phosphate cyclase domain-containing protein 1; RTC domain-containing protein 1
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggcggggccgcgggtggaggtcgatggcagcatcatggaagggggcggccagatcctgagagtctctacggccttgagctgtctcctaggcctcccctcgcgggtgcagaagatccgagccggccggagcacgccaggcctgagttctggaggctggaagtccaagatcaaggtcctgacaaggcctcaacatttatctggactggaaatgattcgagatttgtgtgatgggcaactggagggggcagaaattggctcaacagaaataacctttacaccagagaagatcaaaggtggaatccacacagcagataccaagacagcagggagtgtgtgcctcttgatgcaggtctcaatgccgtgtgttctctttgctgcttctccatcagaacttcatttgaaaggtggaactaatgctgaaatggcaccacagatcgattatacagtgatggtcttcaagccaattgttgaaaaatttggtttcatatttaattgtgacattaaaacaaggggatattacccaaaagggggtggtgaagtgattgttcgaatgtcaccagttaaacaattgaaccctataaatttaactgagcgtggctgtgtgactaagatatatggaagagctttcgttgctggtgttttgccatttaaagtagcaaaagatatggcagcggcagcagttagatgcatcagaaaggagatccgggatttgtatgttaacatccagcctgttcaagaacctaaagaccaagcatttggcaatggaaatggaataataattattgctgagacctccactggctgtttgtttgctggatcatcgcttggtaaacgaggtgtaaatgcagacaaagttggaattgaagctgccgaaatgctattagcaaatcttagacatggtggtactgtggatgagtatctgcaagaccagctgattgttttcatggcattagccaatggagtttccagaataaaaacaggaccagttacactccatacgcaaaccgcgatacattttgctgaacaaatagcaaaggctaaatttattgtgaagaaatcagaagatgaagaagacgccgctaaagatacttatattattgaatgccaaggaattgggatgacaaatccaaatctatag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - UDP-glucose ceramide glucosyltransferase
- pyruvate dehydrogenase kinase, isozyme 4
- Sec61 alpha 2 subunit (S. cerevisiae)
- Sec61 alpha 1 subunit (S. cerevisiae)

Buy RTCD1-RNA terminal phosphate cyclase domain 1 Gene now

Add to cart