SEC61A2-Sec61 alpha 2 subunit (S. cerevisiae) Gene View larger

SEC61A2-Sec61 alpha 2 subunit (S. cerevisiae) Gene

PTXBC026179

New product

121,50 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of SEC61A2-Sec61 alpha 2 subunit (S. cerevisiae) Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about SEC61A2-Sec61 alpha 2 subunit (S. cerevisiae) Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC026179
Product type: DNA & cDNA
Ncbi symbol: SEC61A2
Origin species: Human
Product name: SEC61A2-Sec61 alpha 2 subunit (S. cerevisiae) Gene
Size: 2ug
Accessions: BC026179
Gene id: 55176
Gene description: Sec61 alpha 2 subunit (S. cerevisiae)
Synonyms: protein transport protein Sec61 subunit alpha isoform 2; Sec61 alpha 2 subunit; Sec61 alpha form 2; protein transport protein Sec61 subunit alpha; sec61 alpha-2; Sec61 translocon alpha 2 subunit
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgggcatcaaatttttagaagttatcaaaccattctgtgcagttctaccagaaattcagaaaccggaaaggaaaatccagtttagagagaaggttctgtggactgctataacgctcttcattttcttagtgtgttgtcagatcccactgtttggaatcatgtcatcagattctgcagatcctttctactggatgagagttattctggcttccaatagaggaactttaatggaattgggtatctccccaattgtaacatctggtttgattatgcagttgttagctggagccaaaatcattgaagttggagatacaccgaaagatagagctttattcaatggagcccagaaactgtttggtatgatcattaccattgggcaagccattgtgtatgtcatgacggggatgtatggggaccctgcagaaatgggtgctggaatctgtctcctgatcatcattcagttgtttgttgctggtttgattgtgctgctgttagatgagctgctacagaagggttacggcttggggtctgggatttccctctttattgccaccaacatctgtgagaccattgtctggaaggcctttagtcccactaccattaacactggcagaggtactgagtttgagggtgcagtcatagctctgttccatttgttggccaccaggacggacaaagtccgagctttacgggaggctttttatcggcagaacttacccaatctcatgaacctcattgctacagtttttgtgtttgctgttgttatatatttccaaggatttcgcgttgatctgcccattaagtcggcccgttaccgaggacagtacagcagctaccccatcaaactcttctacacctccaacatccccatcatcctccagtcggccctggtgtccaacctgtatgttatttcccagatgctgtctgttcgatttagtggcaactttttagtaaatttactaggacagtgggccgatgtcagtgggggaggacccgcacgttcttacccagttggaggcctttgttactatctttctcctcctgagtccatgggcgccatctttgaggatcctgtccatgtcgttgtttatatcatcttcatgttggggtcatgtgcattcttctctaagacatggattgaagtgtctggttcctcagccaaagatgtagctaaacagctgaaagaacagcagatggtaatgaggggccaccgagatacctctatggttcatgagcttaatagcgctagagcgtag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - Sec61 alpha 1 subunit (S. cerevisiae)
- thyroid hormone receptor interactor 13
- inositol polyphosphate-5-phosphatase K
- membrane protein, palmitoylated 1, 55kDa

Buy SEC61A2-Sec61 alpha 2 subunit (S. cerevisiae) Gene now

Add to cart