Login to display prices
Login to display prices
TRIP13-thyroid hormone receptor interactor 13 Gene View larger

TRIP13-thyroid hormone receptor interactor 13 Gene

PTXBC000404

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of TRIP13-thyroid hormone receptor interactor 13 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about TRIP13-thyroid hormone receptor interactor 13 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC000404
Product type: DNA & cDNA
Ncbi symbol: TRIP13
Origin species: Human
Product name: TRIP13-thyroid hormone receptor interactor 13 Gene
Size: 2ug
Accessions: BC000404
Gene id: 9319
Gene description: thyroid hormone receptor interactor 13
Synonyms: 16E1BP; pachytene checkpoint protein 2 homolog; 16E1-BP; HPV16 E1 protein binding protein; TR-interacting protein 13; TRIP-13; human papillomavirus type 16 E1 protein-binding protein; thyroid receptor-interacting protein 13; thyroid hormone receptor interactor 13
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggacgaggccgtgggcgacctgaagcaggcgcttccctgtgtggccgagtcgccaacggtccacgtggaggtgcatcagcgcggcagcagcactgcaaagaaagaagacataaacctgagtgttagaaagctactcaacagacataatattgtgtttggtgattacacatggactgagtttgatgaaccttttttgaccagaaatgtgcagtctgtgtctattattgacacagaattaaaggttaaagactcacagcccatcgatttgagtgcatgcactgttgcacttcacattttccagctgaatgaagatggccccagcagtgaaaatctggaggaagagacagaaaacataattgcagcaaatcactgggttctacctgcagctgaattccatgggctttgggacagcttggtatacgatgtggaagtcaaatcccatctcctcgattatgtgatgacaactttactgttttcagacaagaacgtcaacagcaacctcatcacctggaaccgggtggtgctgctccacggtcctcctggcactggaaaaacatccctgtgtaaagcgttagcccagaaattgacaattagactttcaagcaggtaccgatatggccaattaattgaaataaacagccacagcctcttttctaagtggttttcggaaagtggcaagctggtaaccaagatgtttcagaagattcaggatttgattgatgataaagacgccctggtgttcgtgctgattgatgaggtggagagtctcacagccgcccgaaatgcctgcagggcgggcaccgagccatcagatgccatccgcgtggtcaatgctgtcttgacccaaattgatcagattaaaaggcattccaatgttgtgattctgaccacttctaacatcaccgagaagatcgacgtggccttcgtggacagggctgacatcaagcagtacattgggccaccctctgcagcagccatcttcaaaatctacctctcttgtttggaagaactgatgaagtgtcagatcatataccctcgccagcagctgctgaccctccgagagctagagatgattggcttcattgaaaacaacgtgtcaaaattgagccttcttttgaatgacatttcaaggaagagcgagggcctcagcggccgggtcctgagaaaactcccctttctggctcatgcgctgtatgtccaggcccccaccgtcaccatagaggggttcctccaggccctgtctctggcagtggacaagcagtttgaagagagaaagaagcttgcagcttacatctga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - inositol polyphosphate-5-phosphatase K
- membrane protein, palmitoylated 1, 55kDa
- megakaryocyte-associated tyrosine kinase
- thyroid hormone receptor interactor 10