MPP1-membrane protein, palmitoylated 1, 55kDa Gene View larger

MPP1-membrane protein, palmitoylated 1, 55kDa Gene


New product

121,50 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of MPP1-membrane protein, palmitoylated 1, 55kDa Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about MPP1-membrane protein, palmitoylated 1, 55kDa Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC002392
Product type: DNA & cDNA
Ncbi symbol: MPP1
Origin species: Human
Product name: MPP1-membrane protein, palmitoylated 1, 55kDa Gene
Size: 2ug
Accessions: BC002392
Gene id: 4354
Gene description: membrane protein, palmitoylated 1, 55kDa
Synonyms: AAG12; DXS552E; EMP55; MRG1; PEMP; 55 kDa erythrocyte membrane protein; aging-associated gene 12; erythrocyte membrane protein p55; membrane protein, palmitoylated 1; membrane protein, palmitoylated 1, 55kDa; migration-related gene 1; p55; palmitoylated erythrocyte membrane protein; membrane palmitoylated protein 1
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgaccctcaaggcgagcgagggcgagagtgggggcagcatgcacacggcgctctccgacctctacctggagcatttgctgcagaagcgtagtcggccagaggctgtatcgcatccattgaatactgtgaccgaggacatgtacaccaacgggtctcctgccccaggtagccctgcccaggtcaagggacaggaggtgcggaaagtgcgactcatacagtttgagaaggtcacagaagagcccatgggaatcacgctgaagctgaatgaaaaacagtcctgtacggtggccagaattcttcatggtggcatgatccatagacaaggctcccttcacgtgggggatgagatcctagaaatcaatggcacaaatgtgacaaatcattcagtggatcagctgcagaaggcgatgaaagaaaccaaaggaatgatctcattaaaagtaattcccaaccagcaaagccgtcttcctgcactacagatgttcatgagagcgcagtttgactatgatcccaaaaaggacaatctgatcccttgcaaggaggcgggactgaagtttgctactggggacattatccagattatcaacaaggatgacagcaattggtggcagggacgggtggaaggctcctccaaggagtcagcaggattgatcccttcccctgagctgcaggaatggcgagtggcaagtatggctcagtcagctcctagcgaagccccgagctgcagtccctttgggaagaagaagaagtacaaagacaaatatctggccaagcacagctcgatttttgatcagttggatgttgtttcctacgaggaagtcgttcggctccctgcattcaagaggaagaccctggtgctgatcggagccagtggggtgggtcgcagccacattaagaatgccctgctcagccagaatccggagaagtttgtgtaccctgtcccatatacaacacggccgccaaggaagagtgaggaagatgggaaggagtaccactttatctcaacggaggagatgacgaggaacatctctgccaatgagttcttggagtttggcagctaccaaggcaacatgtttggcaccaaatttgaaacagtgcaccagatccataagcagaacaagattgccatccttgacattgagccccagaccctgaaaattgttcggacagcagaactttcgcctttcattgtgttcattgcacctactgaccagggcactcagacagaagccctgcagcagctgcagaaggactctgaggccatccgcagccagtacgctcactactttgacctctcactggtcaataatggtgttgatgaaacccttaagaaattacaagaagccttcgaccaagcgtgcagttctccacagtgggtgcctgtctcctgggtttactaa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - megakaryocyte-associated tyrosine kinase
- thyroid hormone receptor interactor 10
- glutamate receptor, ionotropic, delta 1
- SEC24 family, member A (S. cerevisiae)

Buy MPP1-membrane protein, palmitoylated 1, 55kDa Gene now

Add to cart