Login to display prices
Login to display prices
INPP5K-inositol polyphosphate-5-phosphatase K Gene View larger

INPP5K-inositol polyphosphate-5-phosphatase K Gene

PTXBC004362

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of INPP5K-inositol polyphosphate-5-phosphatase K Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about INPP5K-inositol polyphosphate-5-phosphatase K Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC004362
Product type: DNA & cDNA
Ncbi symbol: INPP5K
Origin species: Human
Product name: INPP5K-inositol polyphosphate-5-phosphatase K Gene
Size: 2ug
Accessions: BC004362
Gene id: 51763
Gene description: inositol polyphosphate-5-phosphatase K
Synonyms: PPS; SKIP; inositol polyphosphate 5-phosphatase K; skeletal muscle and kidney-enriched inositol phosphatase; inositol polyphosphate-5-phosphatase K
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgagctcgcggaagctgagcgggccgaaaggcaggaggctcagcatacacgtcgtgacttggaacgtggcttcggcagcgccccctctagatctcagtgacctgcttcagctgaacaaccggaacctcaatcttgacatatatgttattggtttgcaggaattgaactctgggatcataagcctcctttccgatgctgcctttaatgactcgtggagcagtttcctcatggatgtgctttcccctctgagcttcatcaaggtctcccatgtccgtatgcaggggatcctcttactggtctttgccaagtatcagcatttgccctatatccagattctgtctactaaatccacccccactggcctgtttgggtactgggggaacaaaggtggagtcaacatctgcctgaagctttatggctactatgtcagcatcatcaactgccacctgcctccccacatttccaacaattaccagcggctggagcactttgaccggatcctggagatgcagaattgtgaggggcgagacatcccaaacatcctggaccacgacctcattatctggtttggagacatgaactttcggatcgaggactttgggttgcactttgttcgggaatccattaaaaatcggtgctacggtggcctgtgggagaaggaccagctcagcattgccaagaaacatgacccgctgctccgggagttccaggagggccgcctactcttcccgcccacctacaagtttgataggaactccaacgactatgacaccagtgagaaaaaacgcaagcctgcatggaccgatcgcatcctgtggaggctgaagcggcagccctgtgctggccccgacactcccataccgccggcgtcacacttctccttgtctctgaggggctacagcagccacatgacgtacggcatcagcgaccacaagcctgtctccggcacgttcgacttggagctgaagccattggtgtctgctccgctgatcgtcctgatgcccgaggacctgtggaccgtggaaaatgacatgatggtcagctactcttcaacctcggacttccccagcagcccgtgggactggattggactgtacaaggtggggctgcgggacgttaatgactacgtgtcctatgcctgggtcggggacagcaaggtctcctgcagcgacaacctgaaccaggtttacatcgacatcagcaatatccctaccactgaagatgagtttctcctctgttactacagcaacagtctgcgttctgtggtggggataagcagacccttccagatcccgcctggctccttgagggaggacccactgggtgaagcacagccacagatctga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - membrane protein, palmitoylated 1, 55kDa
- megakaryocyte-associated tyrosine kinase
- thyroid hormone receptor interactor 10
- glutamate receptor, ionotropic, delta 1