IQUB-IQ motif and ubiquitin domain containing Gene View larger

IQUB-IQ motif and ubiquitin domain containing Gene


New product

121,50 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of IQUB-IQ motif and ubiquitin domain containing Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about IQUB-IQ motif and ubiquitin domain containing Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC032838
Product type: DNA & cDNA
Ncbi symbol: IQUB
Origin species: Human
Product name: IQUB-IQ motif and ubiquitin domain containing Gene
Size: 2ug
Accessions: BC032838
Gene id: 154865
Gene description: IQ motif and ubiquitin domain containing
Synonyms: IQ and ubiquitin-like domain-containing protein; IQ motif and ubiquitin domain containing
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgtctaatcaacaggagaagtatgaagctcagaatatagtcaattcaacagaagagagtgatgatgcttttgatactgtcactattccagttccctcagaagagcctcaagagtcagatcaaactgaagagcatgaatctggaatagaacaattcagtgagagccatgcaatacatgttgaggagcagagtgaccaaagcttttcaagcctggaaccagacaatgaacaactcatggaagaggttatatcaccaagacaagtttcatatactccgcaacatcatgaaaagcaatatgcaatgcagaggccaaatgatgatagtttggcatttctggataaaataaagtctgtaaaggaatctttgcaagaatcagtggaagattctctagcaacagtaaaagttgtacttattccagtgggccaggaaattgtaataccttttaaggttgataccattcttaaatatcttaaggaccatttttcacacttattaggtatcccacattctgtactgcagataagatactcaggaaaaattcttaaaaataatgagactctagtacaacatggagttaagccacaggaaattgtacaagtggaaatcttttctacaaatccagatctgtatccagtcagaagaatagatggattaactgatgtctctcaaatcataactgtcactgtccaaactggacttgatcaataccagcaggtacctgttgagattgtcaaatctgactttcacaaaccatttcttggtggattcagacataaagtaacaggagtagagtatcacaatgctggaacacaaactgtacctaaaaggattcccgaaagactcagtatattttgtagggatacgcagacagtttttcagaaaaaaaatctccaacaaactacaaatacaacatccacacagatgactaacattggtgtatatgtatcaaatatgactgataaactggtaacaccaggaaagtatttttcagcagcagaataccatgctcaaagactaaaggcggtgatagtgatacagacttactacaggcaatggcatgctaaaatcttcgtagagaatttaagaagacagaaaagcttaagactggaatgggaaacatag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - RNA terminal phosphate cyclase domain 1
- UDP-glucose ceramide glucosyltransferase
- pyruvate dehydrogenase kinase, isozyme 4
- Sec61 alpha 2 subunit (S. cerevisiae)

Buy IQUB-IQ motif and ubiquitin domain containing Gene now

Add to cart